| Variant ID: vg0817608868 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17608868 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATCGGGAGAGCAGGTCTCTAAAACCTCTGCTTTCGACGTCCTGCACCGGGAGAAGGTGGCAATAAGGTTTTTGGGAAGCGCTTCGCGCGACTGCTCCCT[G/A]
TTCGAACACAACGGCTCGTCTTCATGTTCGTTCGCGTACTGTGCGCCGTCATCAACGTCCGCAACTGCGAGTAATTCCTGCTGAGTAACTGGTCTTCCGG
CCGGAAGACCAGTTACTCAGCAGGAATTACTCGCAGTTGCGGACGTTGATGACGGCGCACAGTACGCGAACGAACATGAAGACGAGCCGTTGTGTTCGAA[C/T]
AGGGAGCAGTCGCGCGAAGCGCTTCCCAAAAACCTTATTGCCACCTTCTCCCGGTGCAGGACGTCGAAAGCAGAGGTTTTAGAGACCTGCTCTCCCGATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 62.10% | 37.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817608868 | G -> A | LOC_Os08g28784.1 | upstream_gene_variant ; 2043.0bp to feature; MODIFIER | silent_mutation | Average:66.626; most accessible tissue: Zhenshan97 young leaf, score: 82.982 | N | N | N | N |
| vg0817608868 | G -> A | LOC_Os08g28790.1 | upstream_gene_variant ; 4703.0bp to feature; MODIFIER | silent_mutation | Average:66.626; most accessible tissue: Zhenshan97 young leaf, score: 82.982 | N | N | N | N |
| vg0817608868 | G -> A | LOC_Os08g28780.1 | downstream_gene_variant ; 3748.0bp to feature; MODIFIER | silent_mutation | Average:66.626; most accessible tissue: Zhenshan97 young leaf, score: 82.982 | N | N | N | N |
| vg0817608868 | G -> A | LOC_Os08g28784-LOC_Os08g28790 | intergenic_region ; MODIFIER | silent_mutation | Average:66.626; most accessible tissue: Zhenshan97 young leaf, score: 82.982 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817608868 | NA | 1.32E-07 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608868 | 3.02E-06 | 1.01E-22 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608868 | 1.78E-07 | 1.60E-19 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608868 | NA | 1.46E-11 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608868 | NA | 4.40E-10 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608868 | NA | 8.04E-11 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608868 | 3.46E-06 | NA | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608868 | NA | 7.88E-07 | mr1836 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608868 | 4.52E-09 | NA | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608868 | 4.46E-06 | 2.38E-14 | mr1980 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/