\
| Variant ID: vg0817608700 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17608700 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, G: 0.03, others allele: 0.00, population size: 245. )
CGCGGAGAAGAGATCGTGCAAGCATCCTGATTAAGCGTTCTGATATCTATATATAAGTTGAGCCGCCGCCTCCACGCAACACACGAAATCAATCTAGGGT[T/G]
TGCCTCCTCCTCTGTATTGCGCCGTTGCTCGTAGTGTACTCCATCCCGCTCGTCGATGTGCACCGGCAATCGGGAGAGCAGGTCTCTAAAACCTCTGCTT
AAGCAGAGGTTTTAGAGACCTGCTCTCCCGATTGCCGGTGCACATCGACGAGCGGGATGGAGTACACTACGAGCAACGGCGCAATACAGAGGAGGAGGCA[A/C]
ACCCTAGATTGATTTCGTGTGTTGCGTGGAGGCGGCGGCTCAACTTATATATAGATATCAGAACGCTTAATCAGGATGCTTGCACGATCTCTTCTCCGCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.10% | 15.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 61.90% | 38.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817608700 | T -> G | LOC_Os08g28784.1 | upstream_gene_variant ; 1875.0bp to feature; MODIFIER | silent_mutation | Average:66.558; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| vg0817608700 | T -> G | LOC_Os08g28790.1 | upstream_gene_variant ; 4871.0bp to feature; MODIFIER | silent_mutation | Average:66.558; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| vg0817608700 | T -> G | LOC_Os08g28780.1 | downstream_gene_variant ; 3580.0bp to feature; MODIFIER | silent_mutation | Average:66.558; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| vg0817608700 | T -> G | LOC_Os08g28784-LOC_Os08g28790 | intergenic_region ; MODIFIER | silent_mutation | Average:66.558; most accessible tissue: Zhenshan97 young leaf, score: 77.422 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817608700 | NA | 1.23E-07 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | 2.65E-06 | 6.11E-21 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | 4.32E-08 | 1.83E-19 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 1.44E-12 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 2.78E-09 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 6.73E-07 | mr1836 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 2.30E-12 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | 2.45E-07 | NA | mr1040_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | 4.11E-06 | 1.99E-06 | mr1040_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 1.96E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 2.31E-18 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | 6.79E-08 | NA | mr1362_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | 3.12E-06 | 3.72E-08 | mr1362_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | 2.37E-07 | 3.22E-18 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 1.93E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 2.32E-11 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 7.61E-08 | mr1578_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 8.43E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 4.30E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | 9.38E-08 | NA | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | 3.97E-06 | 4.23E-07 | mr1836_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 5.23E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817608700 | NA | 7.01E-11 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |