\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817558529:

Variant ID: vg0817558529 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 17558529
Reference Allele: GAATCTAlternative Allele: AAATCT,G
Primary Allele: GAATCTSecondary Allele: AAATCT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCACAAAGCTACTACATTTTAGAGACAATAGAAGTGTATACTCCCTCCGTCCTATAAAAAAACGAATCTAGTATCAGATATGAAATATTCTAGTACAAT[GAATCT/AAATCT,G]
AGATATATGGATGTCCAGATTTGTAGTTCTGTATAACTAGATTTTAACCAGATCAATTACCGAGCTAGCTACCCTCTACTCATCGAGACTAAGGAGGTCG

Reverse complement sequence

CGACCTCCTTAGTCTCGATGAGTAGAGGGTAGCTAGCTCGGTAATTGATCTGGTTAAAATCTAGTTATACAGAACTACAAATCTGGACATCCATATATCT[AGATTC/AGATTT,C]
ATTGTACTAGAATATTTCATATCTGATACTAGATTCGTTTTTTTATAGGACGGAGGGAGTATACACTTCTATTGTCTCTAAAATGTAGTAGCTTTGTGGT

Allele Frequencies:

Populations Population SizeFrequency of GAATCT(primary allele) Frequency of AAATCT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 11.50% 0.74% 29.58% G: 0.11%
All Indica  2759 45.80% 3.70% 1.12% 49.26% G: 0.18%
All Japonica  1512 84.60% 14.40% 0.13% 0.86% NA
Aus  269 22.30% 77.00% 0.00% 0.74% NA
Indica I  595 75.50% 2.70% 1.18% 20.67% NA
Indica II  465 12.00% 2.60% 3.66% 81.08% G: 0.65%
Indica III  913 44.90% 3.00% 0.33% 51.81% NA
Indica Intermediate  786 44.30% 5.90% 0.51% 49.11% G: 0.25%
Temperate Japonica  767 98.40% 0.70% 0.00% 0.91% NA
Tropical Japonica  504 61.70% 37.30% 0.40% 0.60% NA
Japonica Intermediate  241 88.40% 10.40% 0.00% 1.24% NA
VI/Aromatic  96 90.60% 8.30% 0.00% 1.04% NA
Intermediate  90 60.00% 12.20% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817558529 GAATCT -> G LOC_Os08g28710.1 3_prime_UTR_variant ; 76.0bp to feature; MODIFIER silent_mutation Average:81.6; most accessible tissue: Minghui63 young leaf, score: 95.657 N N N N
vg0817558529 GAATCT -> AAATCT LOC_Os08g28710.1 3_prime_UTR_variant ; 81.0bp to feature; MODIFIER silent_mutation Average:81.6; most accessible tissue: Minghui63 young leaf, score: 95.657 N N N N
vg0817558529 GAATCT -> DEL N N silent_mutation Average:81.6; most accessible tissue: Minghui63 young leaf, score: 95.657 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0817558529 GAATC* AAATC* 0.03 0.04 0.01 0.02 0.02 0.02
vg0817558529 GAATC* G -0.04 0.18 0.15 0.1 0.12 0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817558529 2.73E-09 6.54E-09 mr1040 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817558529 5.71E-08 2.08E-11 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817558529 1.66E-06 3.53E-08 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817558529 2.85E-08 NA mr1040_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817558529 1.18E-07 NA mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817558529 2.81E-11 NA mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817558529 NA 8.43E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251