\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817557170:

Variant ID: vg0817557170 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17557170
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


ACCACTGCACCGCCACTCTTCTGGGCATCACCAATATATATATATATATATATATATATATATATATATATATGATAAAAGTAGTCTATATAGATGGGAC[C/T]
CACATAAATAAACTTTAACTATAGCAATCCTCATAATGTATATGGATACAAGGTGACATTAGGAGAAGAGAGAGAAGTAGAGATAGATAATATTATTTAT

Reverse complement sequence

ATAAATAATATTATCTATCTCTACTTCTCTCTCTTCTCCTAATGTCACCTTGTATCCATATACATTATGAGGATTGCTATAGTTAAAGTTTATTTATGTG[G/A]
GTCCCATCTATATAGACTACTTTTATCATATATATATATATATATATATATATATATATATATATATTGGTGATGCCCAGAAGAGTGGCGGTGCAGTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.80% 19.50% 1.74% 0.00% NA
All Indica  2759 74.30% 22.80% 2.94% 0.00% NA
All Japonica  1512 85.00% 15.00% 0.00% 0.00% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 35.10% 61.20% 3.70% 0.00% NA
Indica II  465 92.50% 5.60% 1.94% 0.00% NA
Indica III  913 85.80% 10.20% 4.05% 0.00% NA
Indica Intermediate  786 79.90% 18.40% 1.65% 0.00% NA
Temperate Japonica  767 97.90% 2.10% 0.00% 0.00% NA
Tropical Japonica  504 66.70% 33.30% 0.00% 0.00% NA
Japonica Intermediate  241 82.20% 17.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817557170 C -> T LOC_Os08g28710.1 downstream_gene_variant ; 892.0bp to feature; MODIFIER silent_mutation Average:73.629; most accessible tissue: Zhenshan97 panicle, score: 97.422 N N N N
vg0817557170 C -> T LOC_Os08g28700-LOC_Os08g28710 intergenic_region ; MODIFIER silent_mutation Average:73.629; most accessible tissue: Zhenshan97 panicle, score: 97.422 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0817557170 C T -0.09 -0.09 -0.05 -0.26 -0.09 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817557170 NA 1.16E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 1.07E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 7.01E-14 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 1.02E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 2.97E-06 1.43E-07 mr1836 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 2.41E-06 mr1836 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 5.29E-13 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 6.98E-07 mr1362_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 9.10E-06 4.55E-14 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 4.83E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 2.52E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 1.75E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 8.44E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 4.87E-06 mr1836_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 7.67E-07 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817557170 NA 5.54E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251