\
| Variant ID: vg0817537465 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17537465 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCATCCAATCCGAATCTGATTTAGGTTTTGGCCAAGGGGGTGTGTGCCCTAGGGCAACCCTTGGACATCCCTAATCATATTTATTCAATAGCCATCATC[G/A]
TTTAGAGTCGGGTTTTGCTTAGATTAATCTATCAAGAATAGTTTCGCCGCTAGTTCGGTTTGTGGAACCCCAAATTCGAGTGCTCAATCATTCATATGAA
TTCATATGAATGATTGAGCACTCGAATTTGGGGTTCCACAAACCGAACTAGCGGCGAAACTATTCTTGATAGATTAATCTAAGCAAAACCCGACTCTAAA[C/T]
GATGATGGCTATTGAATAAATATGATTAGGGATGTCCAAGGGTTGCCCTAGGGCACACACCCCCTTGGCCAAAACCTAAATCAGATTCGGATTGGATGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 89.80% | 10.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817537465 | G -> A | LOC_Os08g28700.1 | downstream_gene_variant ; 734.0bp to feature; MODIFIER | silent_mutation | Average:63.517; most accessible tissue: Zhenshan97 root, score: 85.677 | N | N | N | N |
| vg0817537465 | G -> A | LOC_Os08g28690-LOC_Os08g28700 | intergenic_region ; MODIFIER | silent_mutation | Average:63.517; most accessible tissue: Zhenshan97 root, score: 85.677 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817537465 | NA | 1.61E-07 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | NA | 4.63E-14 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | 5.50E-06 | 4.82E-16 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | NA | 8.02E-08 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | NA | 2.25E-09 | mr1980 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | 3.44E-06 | 5.75E-16 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | 4.37E-08 | 1.57E-17 | mr1410_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | NA | 3.11E-11 | mr1533_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | NA | 7.12E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | NA | 8.89E-06 | mr1836_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817537465 | 3.44E-06 | 2.84E-12 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |