Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817460370:

Variant ID: vg0817460370 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17460370
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAACGTCGTTGTACCCAGGTTGCGAGCAGAGGCATAAAAAGTTGGATACCACTTTGGAGTTCTTGTAATGGAAGGCAAAAAATGGTGTTAGTGACAAGG[C/T]
ATTTGGCGATTTATTGAAACTCGTCAAGAACATTTTTCCGGAGGGAAACAAATTGCTCGAGACAACGTACGAGGCTAAGAAGATAGTCTACCCTCTAAGA

Reverse complement sequence

TCTTAGAGGGTAGACTATCTTCTTAGCCTCGTACGTTGTCTCGAGCAATTTGTTTCCCTCCGGAAAAATGTTCTTGACGAGTTTCAATAAATCGCCAAAT[G/A]
CCTTGTCACTAACACCATTTTTTGCCTTCCATTACAAGAACTCCAAAGTGGTATCCAACTTTTTATGCCTCTGCTCGCAACCTGGGTACAACGACGTTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	6.20%	10.50%	19.93%	NA
All Indica	2759	61.20%	0.30%	12.90%	25.63%	NA
All Japonica	1512	65.40%	18.30%	5.69%	10.65%	NA
Aus	269	62.80%	0.00%	16.73%	20.45%	NA
Indica I	595	67.40%	0.20%	20.34%	12.10%	NA
Indica II	465	52.00%	0.40%	15.48%	32.04%	NA
Indica III	913	63.90%	0.10%	6.46%	29.57%	NA
Indica Intermediate	786	58.90%	0.40%	13.23%	27.48%	NA
Temperate Japonica	767	93.60%	2.10%	3.52%	0.78%	NA
Tropical Japonica	504	18.80%	45.80%	8.73%	26.59%	NA
Japonica Intermediate	241	73.00%	12.00%	6.22%	8.71%	NA
VI/Aromatic	96	92.70%	1.00%	1.04%	5.21%	NA
Intermediate	90	64.40%	11.10%	8.89%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817460370	C -> T	LOC_Os08g28590.1	missense_variant ; p.Ala67Val; MODERATE	nonsynonymous_codon ; A67V	Average:7.093; most accessible tissue: Callus, score: 13.15	unknown	unknown	DELETERIOUS	0.02
vg0817460370	C -> DEL	LOC_Os08g28590.1	N	frameshift_variant	Average:7.093; most accessible tissue: Callus, score: 13.15	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817460370	NA	7.33E-07	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	4.01E-08	2.29E-25	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.89E-15	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	5.14E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	2.86E-07	6.03E-21	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.24E-13	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	6.50E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	2.17E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.58E-08	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	2.79E-07	2.79E-21	mr1676	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	3.93E-10	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.92E-11	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.37E-12	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.15E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	2.70E-10	mr1980	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	1.65E-06	2.32E-24	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	3.44E-15	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	3.77E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	3.67E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	1.53E-06	2.75E-21	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	6.90E-14	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	3.65E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	6.79E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.70E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.52E-13	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.63E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	7.43E-07	9.97E-15	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370	NA	1.51E-13	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251