\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817460370:

Variant ID: vg0817460370 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17460370
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAACGTCGTTGTACCCAGGTTGCGAGCAGAGGCATAAAAAGTTGGATACCACTTTGGAGTTCTTGTAATGGAAGGCAAAAAATGGTGTTAGTGACAAGG[C/T]
ATTTGGCGATTTATTGAAACTCGTCAAGAACATTTTTCCGGAGGGAAACAAATTGCTCGAGACAACGTACGAGGCTAAGAAGATAGTCTACCCTCTAAGA

Reverse complement sequence

TCTTAGAGGGTAGACTATCTTCTTAGCCTCGTACGTTGTCTCGAGCAATTTGTTTCCCTCCGGAAAAATGTTCTTGACGAGTTTCAATAAATCGCCAAAT[G/A]
CCTTGTCACTAACACCATTTTTTGCCTTCCATTACAAGAACTCCAAAGTGGTATCCAACTTTTTATGCCTCTGCTCGCAACCTGGGTACAACGACGTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 6.20% 10.50% 19.93% NA
All Indica  2759 61.20% 0.30% 12.90% 25.63% NA
All Japonica  1512 65.40% 18.30% 5.69% 10.65% NA
Aus  269 62.80% 0.00% 16.73% 20.45% NA
Indica I  595 67.40% 0.20% 20.34% 12.10% NA
Indica II  465 52.00% 0.40% 15.48% 32.04% NA
Indica III  913 63.90% 0.10% 6.46% 29.57% NA
Indica Intermediate  786 58.90% 0.40% 13.23% 27.48% NA
Temperate Japonica  767 93.60% 2.10% 3.52% 0.78% NA
Tropical Japonica  504 18.80% 45.80% 8.73% 26.59% NA
Japonica Intermediate  241 73.00% 12.00% 6.22% 8.71% NA
VI/Aromatic  96 92.70% 1.00% 1.04% 5.21% NA
Intermediate  90 64.40% 11.10% 8.89% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817460370 C -> T LOC_Os08g28590.1 missense_variant ; p.Ala67Val; MODERATE nonsynonymous_codon ; A67V Average:7.093; most accessible tissue: Callus, score: 13.15 unknown unknown DELETERIOUS 0.02
vg0817460370 C -> DEL LOC_Os08g28590.1 N frameshift_variant Average:7.093; most accessible tissue: Callus, score: 13.15 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817460370 NA 7.33E-07 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 4.01E-08 2.29E-25 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.89E-15 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 5.14E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 2.86E-07 6.03E-21 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.24E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 6.50E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 2.17E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.58E-08 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 2.79E-07 2.79E-21 mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 3.93E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.92E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.37E-12 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.15E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 2.70E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 1.65E-06 2.32E-24 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 3.44E-15 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 3.77E-10 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 3.67E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 1.53E-06 2.75E-21 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 6.90E-14 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 3.65E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 6.79E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.70E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.52E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.63E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 7.43E-07 9.97E-15 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817460370 NA 1.51E-13 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251