\
| Variant ID: vg0817400578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17400578 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGAAAGGAAAAATCGTGTTTTGGTTGAGATGGCTAGAACGATGTTGGATGACTATAAAACTCCTAGAAAATTTTGGGCTGAAGCTTTTAACACAGCTTGT[T/A]
ATATTTCAACTCGGGTTTTCTTGAGATCTAAACTTGGAAAAACTTCTTATGAACTTCGATTTGGTCATCAACCCAAAGTTTCACATTTGCGTGTTTTTGG
CCAAAAACACGCAAATGTGAAACTTTGGGTTGATGACCAAATCGAAGTTCATAAGAAGTTTTTCCAAGTTTAGATCTCAAGAAAACCCGAGTTGAAATAT[A/T]
ACAAGCTGTGTTAAAAGCTTCAGCCCAAAATTTTCTAGGAGTTTTATAGTCATCCAACATCGTTCTAGCCATCTCAACCAAAACACGATTTTTCCTTTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.90% | 2.80% | 7.53% | 38.81% | NA |
| All Indica | 2759 | 25.90% | 0.00% | 9.93% | 64.15% | NA |
| All Japonica | 1512 | 84.50% | 8.30% | 4.89% | 2.31% | NA |
| Aus | 269 | 97.00% | 0.00% | 1.12% | 1.86% | NA |
| Indica I | 595 | 38.70% | 0.00% | 7.06% | 54.29% | NA |
| Indica II | 465 | 15.70% | 0.00% | 7.10% | 77.20% | NA |
| Indica III | 913 | 23.40% | 0.00% | 14.57% | 61.99% | NA |
| Indica Intermediate | 786 | 25.20% | 0.00% | 8.40% | 66.41% | NA |
| Temperate Japonica | 767 | 75.10% | 16.20% | 8.08% | 0.65% | NA |
| Tropical Japonica | 504 | 93.30% | 0.00% | 1.19% | 5.56% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.80% | 2.49% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 65.60% | 4.40% | 4.44% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817400578 | T -> A | LOC_Os08g28510.1 | downstream_gene_variant ; 4646.0bp to feature; MODIFIER | silent_mutation | Average:19.586; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| vg0817400578 | T -> A | LOC_Os08g28500.1 | intron_variant ; MODIFIER | silent_mutation | Average:19.586; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| vg0817400578 | T -> DEL | N | N | silent_mutation | Average:19.586; most accessible tissue: Zhenshan97 root, score: 34.536 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817400578 | 2.03E-07 | NA | mr1300 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817400578 | NA | 2.04E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817400578 | 2.41E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817400578 | 5.55E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817400578 | NA | 4.23E-09 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817400578 | 7.41E-06 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817400578 | NA | 1.60E-07 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |