Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817392737:

Variant ID: vg0817392737 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17392737
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCGATTGGTTTCTTCGCCTCTACGGCTGTGCAACTTTGTCACCGGCACCGACAAACTCTATTGCCGCTACTTCGCTAGTTTTGCTACTTCACCAGCCA[C/T]
GACGTCTACAAGAGCTTCGTTATATCGGCATGCGTCACCAAATATGATGCCATGTTATTTTACTACAACAAGTGGTATTCCAATCTTCAATATTTCTACT

Reverse complement sequence

AGTAGAAATATTGAAGATTGGAATACCACTTGTTGTAGTAAAATAACATGGCATCATATTTGGTGACGCATGCCGATATAACGAAGCTCTTGTAGACGTC[G/A]
TGGCTGGTGAAGTAGCAAAACTAGCGAAGTAGCGGCAATAGAGTTTGTCGGTGCCGGTGACAAAGTTGCACAGCCGTAGAGGCGAAGAAACCAATCGGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.60%	11.40%	5.86%	15.15%	NA
All Indica	2759	57.30%	8.30%	9.82%	24.54%	NA
All Japonica	1512	96.40%	1.60%	0.26%	1.79%	NA
Aus	269	1.50%	98.10%	0.00%	0.37%	NA
Indica I	595	63.40%	3.40%	16.81%	16.47%	NA
Indica II	465	47.50%	9.00%	9.25%	34.19%	NA
Indica III	913	60.90%	7.40%	5.91%	25.74%	NA
Indica Intermediate	786	54.30%	12.70%	9.41%	23.54%	NA
Temperate Japonica	767	99.10%	0.30%	0.13%	0.52%	NA
Tropical Japonica	504	92.10%	3.20%	0.60%	4.17%	NA
Japonica Intermediate	241	96.70%	2.50%	0.00%	0.83%	NA
VI/Aromatic	96	92.70%	6.20%	0.00%	1.04%	NA
Intermediate	90	72.20%	14.40%	2.22%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817392737	C -> T	LOC_Os08g28500.1	upstream_gene_variant ; 4406.0bp to feature; MODIFIER	silent_mutation	Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0817392737	C -> T	LOC_Os08g28490.1	downstream_gene_variant ; 371.0bp to feature; MODIFIER	silent_mutation	Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0817392737	C -> T	LOC_Os08g28490-LOC_Os08g28500	intergenic_region ; MODIFIER	silent_mutation	Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg0817392737	C -> DEL	N	N	silent_mutation	Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817392737	NA	5.33E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	6.52E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	2.42E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	5.68E-07	mr1351	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	4.91E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	5.77E-07	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	1.61E-08	mr1523	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	5.77E-07	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	9.53E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	6.66E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	1.43E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737	NA	2.68E-10	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251