\
| Variant ID: vg0817392737 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17392737 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCCGATTGGTTTCTTCGCCTCTACGGCTGTGCAACTTTGTCACCGGCACCGACAAACTCTATTGCCGCTACTTCGCTAGTTTTGCTACTTCACCAGCCA[C/T]
GACGTCTACAAGAGCTTCGTTATATCGGCATGCGTCACCAAATATGATGCCATGTTATTTTACTACAACAAGTGGTATTCCAATCTTCAATATTTCTACT
AGTAGAAATATTGAAGATTGGAATACCACTTGTTGTAGTAAAATAACATGGCATCATATTTGGTGACGCATGCCGATATAACGAAGCTCTTGTAGACGTC[G/A]
TGGCTGGTGAAGTAGCAAAACTAGCGAAGTAGCGGCAATAGAGTTTGTCGGTGCCGGTGACAAAGTTGCACAGCCGTAGAGGCGAAGAAACCAATCGGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.60% | 11.40% | 5.86% | 15.15% | NA |
| All Indica | 2759 | 57.30% | 8.30% | 9.82% | 24.54% | NA |
| All Japonica | 1512 | 96.40% | 1.60% | 0.26% | 1.79% | NA |
| Aus | 269 | 1.50% | 98.10% | 0.00% | 0.37% | NA |
| Indica I | 595 | 63.40% | 3.40% | 16.81% | 16.47% | NA |
| Indica II | 465 | 47.50% | 9.00% | 9.25% | 34.19% | NA |
| Indica III | 913 | 60.90% | 7.40% | 5.91% | 25.74% | NA |
| Indica Intermediate | 786 | 54.30% | 12.70% | 9.41% | 23.54% | NA |
| Temperate Japonica | 767 | 99.10% | 0.30% | 0.13% | 0.52% | NA |
| Tropical Japonica | 504 | 92.10% | 3.20% | 0.60% | 4.17% | NA |
| Japonica Intermediate | 241 | 96.70% | 2.50% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 72.20% | 14.40% | 2.22% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817392737 | C -> T | LOC_Os08g28500.1 | upstream_gene_variant ; 4406.0bp to feature; MODIFIER | silent_mutation | Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0817392737 | C -> T | LOC_Os08g28490.1 | downstream_gene_variant ; 371.0bp to feature; MODIFIER | silent_mutation | Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0817392737 | C -> T | LOC_Os08g28490-LOC_Os08g28500 | intergenic_region ; MODIFIER | silent_mutation | Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| vg0817392737 | C -> DEL | N | N | silent_mutation | Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817392737 | NA | 5.33E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 6.52E-07 | mr1126 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 2.42E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 5.68E-07 | mr1351 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 4.91E-07 | mr1365 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 5.77E-07 | mr1415 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 1.61E-08 | mr1523 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 5.77E-07 | mr1567 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 9.53E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 6.66E-07 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 1.43E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817392737 | NA | 2.68E-10 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |