\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817392737:

Variant ID: vg0817392737 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17392737
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCGATTGGTTTCTTCGCCTCTACGGCTGTGCAACTTTGTCACCGGCACCGACAAACTCTATTGCCGCTACTTCGCTAGTTTTGCTACTTCACCAGCCA[C/T]
GACGTCTACAAGAGCTTCGTTATATCGGCATGCGTCACCAAATATGATGCCATGTTATTTTACTACAACAAGTGGTATTCCAATCTTCAATATTTCTACT

Reverse complement sequence

AGTAGAAATATTGAAGATTGGAATACCACTTGTTGTAGTAAAATAACATGGCATCATATTTGGTGACGCATGCCGATATAACGAAGCTCTTGTAGACGTC[G/A]
TGGCTGGTGAAGTAGCAAAACTAGCGAAGTAGCGGCAATAGAGTTTGTCGGTGCCGGTGACAAAGTTGCACAGCCGTAGAGGCGAAGAAACCAATCGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 11.40% 5.86% 15.15% NA
All Indica  2759 57.30% 8.30% 9.82% 24.54% NA
All Japonica  1512 96.40% 1.60% 0.26% 1.79% NA
Aus  269 1.50% 98.10% 0.00% 0.37% NA
Indica I  595 63.40% 3.40% 16.81% 16.47% NA
Indica II  465 47.50% 9.00% 9.25% 34.19% NA
Indica III  913 60.90% 7.40% 5.91% 25.74% NA
Indica Intermediate  786 54.30% 12.70% 9.41% 23.54% NA
Temperate Japonica  767 99.10% 0.30% 0.13% 0.52% NA
Tropical Japonica  504 92.10% 3.20% 0.60% 4.17% NA
Japonica Intermediate  241 96.70% 2.50% 0.00% 0.83% NA
VI/Aromatic  96 92.70% 6.20% 0.00% 1.04% NA
Intermediate  90 72.20% 14.40% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817392737 C -> T LOC_Os08g28500.1 upstream_gene_variant ; 4406.0bp to feature; MODIFIER silent_mutation Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0817392737 C -> T LOC_Os08g28490.1 downstream_gene_variant ; 371.0bp to feature; MODIFIER silent_mutation Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0817392737 C -> T LOC_Os08g28490-LOC_Os08g28500 intergenic_region ; MODIFIER silent_mutation Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg0817392737 C -> DEL N N silent_mutation Average:25.578; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817392737 NA 5.33E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 6.52E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 2.42E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 5.68E-07 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 4.91E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 5.77E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 1.61E-08 mr1523 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 5.77E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 9.53E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 6.66E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 1.43E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817392737 NA 2.68E-10 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251