\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817380259:

Variant ID: vg0817380259 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17380259
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCTTGAACTCAGCAATCATCTTGGCAATCCGACGCCGGGCCATGGTCTTGGTCAGCAAATTCCTGCATTTGACGATGAACCCATCCGGATTAGCGGAT[C/T]
CGTCGACGACATGGAGCATGAACTCGTCGAGGCTGTCCTCGATGTCGTAGGAGAGCTCCCGCACCTCCCTCGTCCAGGCCTTGTCCTGAGGGTCAGCGTT

Reverse complement sequence

AACGCTGACCCTCAGGACAAGGCCTGGACGAGGGAGGTGCGGGAGCTCTCCTACGACATCGAGGACAGCCTCGACGAGTTCATGCTCCATGTCGTCGACG[G/A]
ATCCGCTAATCCGGATGGGTTCATCGTCAAATGCAGGAATTTGCTGACCAAGACCATGGCCCGGCGTCGGATTGCCAAGATGATTGCTGAGTTCAAGGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 43.00% 0.06% 0.06% NA
All Indica  2759 92.40% 7.40% 0.11% 0.07% NA
All Japonica  1512 3.30% 96.60% 0.00% 0.07% NA
Aus  269 18.60% 81.40% 0.00% 0.00% NA
Indica I  595 94.30% 5.70% 0.00% 0.00% NA
Indica II  465 90.30% 9.20% 0.22% 0.22% NA
Indica III  913 92.60% 7.30% 0.11% 0.00% NA
Indica Intermediate  786 92.00% 7.80% 0.13% 0.13% NA
Temperate Japonica  767 0.90% 99.00% 0.00% 0.13% NA
Tropical Japonica  504 6.90% 93.10% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 38.90% 61.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817380259 C -> T LOC_Os08g28470.1 missense_variant ; p.Gly317Glu; MODERATE nonsynonymous_codon ; G317E Average:78.812; most accessible tissue: Minghui63 panicle, score: 89.175 possibly damaging -1.591 TOLERATED 0.16
vg0817380259 C -> DEL LOC_Os08g28470.1 N frameshift_variant Average:78.812; most accessible tissue: Minghui63 panicle, score: 89.175 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0817380259 C T -0.03 -0.03 -0.03 -0.05 -0.05 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817380259 NA 5.75E-09 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 9.33E-07 9.32E-07 mr1040 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 2.17E-15 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 7.07E-28 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 1.68E-13 mr1581 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 9.69E-10 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 9.19E-06 9.19E-06 mr1852 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 9.84E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 3.41E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 4.44E-20 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 2.19E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 1.53E-18 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 NA 1.27E-19 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817380259 2.32E-06 7.39E-07 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251