Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817366906:

Variant ID: vg0817366906 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17366906
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGATCTGGTCGGCCGTATCACAGATCCATCTTCACCAGGACCGCCGACAGCTCCTCCATCATCTCACCGCCTCTGACTCCTTCCCACCGCCGTGTTCCT[A/C]
CTCCTAGCGACAAGGCCGAGGGTAGAAGAAGAAATCTCTGGTGCGGGAGCAGTGTCCATGAGTATGAGGCTAGGCATGACATCGCCCAACACAGAGCCTA

Reverse complement sequence

TAGGCTCTGTGTTGGGCGATGTCATGCCTAGCCTCATACTCATGGACACTGCTCCCGCACCAGAGATTTCTTCTTCTACCCTCGGCCTTGTCGCTAGGAG[T/G]
AGGAACACGGCGGTGGGAAGGAGTCAGAGGCGGTGAGATGATGGAGGAGCTGTCGGCGGTCCTGGTGAAGATGGATCTGTGATACGGCCGACCAGATCTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.90%	40.20%	1.93%	7.91%	NA
All Indica	2759	80.50%	8.70%	2.97%	7.76%	NA
All Japonica	1512	3.20%	95.60%	0.26%	0.93%	NA
Aus	269	19.70%	28.30%	1.12%	50.93%	NA
Indica I	595	87.60%	6.40%	3.70%	2.35%	NA
Indica II	465	80.40%	7.30%	2.15%	10.11%	NA
Indica III	913	72.40%	13.70%	2.63%	11.28%	NA
Indica Intermediate	786	84.70%	5.60%	3.31%	6.36%	NA
Temperate Japonica	767	1.40%	98.60%	0.00%	0.00%	NA
Tropical Japonica	504	5.80%	90.70%	0.79%	2.78%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	92.70%	0.00%	1.04%	NA
Intermediate	90	34.40%	54.40%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817366906	A -> C	LOC_Os08g28450.1	upstream_gene_variant ; 3400.0bp to feature; MODIFIER	silent_mutation	Average:63.684; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0817366906	A -> C	LOC_Os08g28460.1	downstream_gene_variant ; 653.0bp to feature; MODIFIER	silent_mutation	Average:63.684; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0817366906	A -> C	LOC_Os08g28450-LOC_Os08g28460	intergenic_region ; MODIFIER	silent_mutation	Average:63.684; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N
vg0817366906	A -> DEL	N	N	silent_mutation	Average:63.684; most accessible tissue: Minghui63 young leaf, score: 81.195	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817366906	5.60E-06	2.16E-09	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	1.49E-08	1.49E-08	mr1040	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	NA	7.48E-13	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	NA	7.03E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	NA	3.96E-08	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	2.98E-06	2.98E-06	mr1836	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	1.96E-08	1.96E-08	mr1852	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	NA	3.01E-22	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	NA	5.66E-18	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	NA	1.08E-21	mr1362_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	NA	4.83E-20	mr1581_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	NA	3.78E-19	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906	7.64E-06	2.54E-06	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251