\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817366906:

Variant ID: vg0817366906 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17366906
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGATCTGGTCGGCCGTATCACAGATCCATCTTCACCAGGACCGCCGACAGCTCCTCCATCATCTCACCGCCTCTGACTCCTTCCCACCGCCGTGTTCCT[A/C]
CTCCTAGCGACAAGGCCGAGGGTAGAAGAAGAAATCTCTGGTGCGGGAGCAGTGTCCATGAGTATGAGGCTAGGCATGACATCGCCCAACACAGAGCCTA

Reverse complement sequence

TAGGCTCTGTGTTGGGCGATGTCATGCCTAGCCTCATACTCATGGACACTGCTCCCGCACCAGAGATTTCTTCTTCTACCCTCGGCCTTGTCGCTAGGAG[T/G]
AGGAACACGGCGGTGGGAAGGAGTCAGAGGCGGTGAGATGATGGAGGAGCTGTCGGCGGTCCTGGTGAAGATGGATCTGTGATACGGCCGACCAGATCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 40.20% 1.93% 7.91% NA
All Indica  2759 80.50% 8.70% 2.97% 7.76% NA
All Japonica  1512 3.20% 95.60% 0.26% 0.93% NA
Aus  269 19.70% 28.30% 1.12% 50.93% NA
Indica I  595 87.60% 6.40% 3.70% 2.35% NA
Indica II  465 80.40% 7.30% 2.15% 10.11% NA
Indica III  913 72.40% 13.70% 2.63% 11.28% NA
Indica Intermediate  786 84.70% 5.60% 3.31% 6.36% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 90.70% 0.79% 2.78% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 0.00% 1.04% NA
Intermediate  90 34.40% 54.40% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817366906 A -> C LOC_Os08g28450.1 upstream_gene_variant ; 3400.0bp to feature; MODIFIER silent_mutation Average:63.684; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0817366906 A -> C LOC_Os08g28460.1 downstream_gene_variant ; 653.0bp to feature; MODIFIER silent_mutation Average:63.684; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0817366906 A -> C LOC_Os08g28450-LOC_Os08g28460 intergenic_region ; MODIFIER silent_mutation Average:63.684; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N
vg0817366906 A -> DEL N N silent_mutation Average:63.684; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817366906 5.60E-06 2.16E-09 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 1.49E-08 1.49E-08 mr1040 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 NA 7.48E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 NA 7.03E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 NA 3.96E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 2.98E-06 2.98E-06 mr1836 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 1.96E-08 1.96E-08 mr1852 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 NA 3.01E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 NA 5.66E-18 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 NA 1.08E-21 mr1362_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 NA 4.83E-20 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 NA 3.78E-19 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817366906 7.64E-06 2.54E-06 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251