\
| Variant ID: vg0817362261 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17362261 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACAATCTACCATGACACCTTTGCTTTTACGACACTTGGGGCAAGAAAGCACTTCATTGTTTTTCACAACATCTTCCTTGTACTCAACATGACCTAAAGC[G/A]
TCCTTTAACTTCAACTTATTCAAAGTACATGTTGAGCAATCCAAAACACTATGAGGTTGTTTTAACTTTTTAGCACAAATCATGTTAAACATCAAACTAG
CTAGTTTGATGTTTAACATGATTTGTGCTAAAAAGTTAAAACAACCTCATAGTGTTTTGGATTGCTCAACATGTACTTTGAATAAGTTGAAGTTAAAGGA[C/T]
GCTTTAGGTCATGTTGAGTACAAGGAAGATGTTGTGAAAAACAATGAAGTGCTTTCTTGCCCCAAGTGTCGTAAAAGCAAAGGTGTCATGGTAGATTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.40% | 6.30% | 0.93% | 57.38% | NA |
| All Indica | 2759 | 4.00% | 6.90% | 1.34% | 87.82% | NA |
| All Japonica | 1512 | 94.00% | 1.90% | 0.20% | 3.84% | NA |
| Aus | 269 | 1.10% | 27.50% | 0.37% | 71.00% | NA |
| Indica I | 595 | 7.40% | 3.00% | 1.01% | 88.57% | NA |
| Indica II | 465 | 3.20% | 5.80% | 1.94% | 89.03% | NA |
| Indica III | 913 | 1.80% | 13.30% | 1.20% | 83.79% | NA |
| Indica Intermediate | 786 | 4.50% | 2.90% | 1.40% | 91.22% | NA |
| Temperate Japonica | 767 | 95.30% | 3.70% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 90.90% | 0.20% | 0.40% | 8.53% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 54.40% | 4.40% | 3.33% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817362261 | G -> A | LOC_Os08g28450.1 | synonymous_variant ; p.Asp272Asp; LOW | synonymous_codon | Average:6.103; most accessible tissue: Callus, score: 19.496 | N | N | N | N |
| vg0817362261 | G -> DEL | LOC_Os08g28450.1 | N | frameshift_variant | Average:6.103; most accessible tissue: Callus, score: 19.496 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817362261 | 3.12E-06 | 2.11E-07 | mr1040 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817362261 | 9.36E-08 | 9.36E-08 | mr1040 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817362261 | 4.28E-06 | 7.40E-06 | mr1344 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817362261 | 4.92E-06 | 4.92E-06 | mr1362 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817362261 | 7.30E-06 | 9.30E-09 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817362261 | 2.25E-07 | 2.25E-07 | mr1852 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |