\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817362261:

Variant ID: vg0817362261 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17362261
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACAATCTACCATGACACCTTTGCTTTTACGACACTTGGGGCAAGAAAGCACTTCATTGTTTTTCACAACATCTTCCTTGTACTCAACATGACCTAAAGC[G/A]
TCCTTTAACTTCAACTTATTCAAAGTACATGTTGAGCAATCCAAAACACTATGAGGTTGTTTTAACTTTTTAGCACAAATCATGTTAAACATCAAACTAG

Reverse complement sequence

CTAGTTTGATGTTTAACATGATTTGTGCTAAAAAGTTAAAACAACCTCATAGTGTTTTGGATTGCTCAACATGTACTTTGAATAAGTTGAAGTTAAAGGA[C/T]
GCTTTAGGTCATGTTGAGTACAAGGAAGATGTTGTGAAAAACAATGAAGTGCTTTCTTGCCCCAAGTGTCGTAAAAGCAAAGGTGTCATGGTAGATTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.40% 6.30% 0.93% 57.38% NA
All Indica  2759 4.00% 6.90% 1.34% 87.82% NA
All Japonica  1512 94.00% 1.90% 0.20% 3.84% NA
Aus  269 1.10% 27.50% 0.37% 71.00% NA
Indica I  595 7.40% 3.00% 1.01% 88.57% NA
Indica II  465 3.20% 5.80% 1.94% 89.03% NA
Indica III  913 1.80% 13.30% 1.20% 83.79% NA
Indica Intermediate  786 4.50% 2.90% 1.40% 91.22% NA
Temperate Japonica  767 95.30% 3.70% 0.13% 0.91% NA
Tropical Japonica  504 90.90% 0.20% 0.40% 8.53% NA
Japonica Intermediate  241 96.70% 0.00% 0.00% 3.32% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 54.40% 4.40% 3.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817362261 G -> A LOC_Os08g28450.1 synonymous_variant ; p.Asp272Asp; LOW synonymous_codon Average:6.103; most accessible tissue: Callus, score: 19.496 N N N N
vg0817362261 G -> DEL LOC_Os08g28450.1 N frameshift_variant Average:6.103; most accessible tissue: Callus, score: 19.496 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817362261 3.12E-06 2.11E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817362261 9.36E-08 9.36E-08 mr1040 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817362261 4.28E-06 7.40E-06 mr1344 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817362261 4.92E-06 4.92E-06 mr1362 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817362261 7.30E-06 9.30E-09 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817362261 2.25E-07 2.25E-07 mr1852 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251