\
| Variant ID: vg0817358920 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17358920 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTAGAACCAATTGGTGTTGAAATTGGCCTGCAACTCTCCATCTTGAACCGTCTCAAAAGATCCTTTGTGTACTTCGTTTGATGCACAAATATACCTTGAG[A/G]
TGTTTGCTTAATTTGCAATCCCAAAAAATACGATAACTCACCCATCATGCTCATCTCAAATTCCCTGCGCATAGTCTCAGCAAACACCACAACCAAAGCG
CGCTTTGGTTGTGGTGTTTGCTGAGACTATGCGCAGGGAATTTGAGATGAGCATGATGGGTGAGTTATCGTATTTTTTGGGATTGCAAATTAAGCAAACA[T/C]
CTCAAGGTATATTTGTGCATCAAACGAAGTACACAAAGGATCTTTTGAGACGGTTCAAGATGGAGAGTTGCAGGCCAATTTCAACACCAATTGGTTCTAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.00% | 6.30% | 1.14% | 56.60% | NA |
| All Indica | 2759 | 4.90% | 6.90% | 1.85% | 86.44% | NA |
| All Japonica | 1512 | 94.00% | 2.00% | 0.07% | 3.97% | NA |
| Aus | 269 | 1.50% | 27.50% | 0.37% | 70.63% | NA |
| Indica I | 595 | 8.10% | 3.00% | 1.34% | 87.56% | NA |
| Indica II | 465 | 4.10% | 5.80% | 1.51% | 88.60% | NA |
| Indica III | 913 | 1.80% | 13.10% | 2.08% | 83.02% | NA |
| Indica Intermediate | 786 | 6.50% | 3.10% | 2.16% | 88.30% | NA |
| Temperate Japonica | 767 | 95.30% | 3.80% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 90.70% | 0.20% | 0.20% | 8.93% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 57.80% | 4.40% | 1.11% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817358920 | A -> G | LOC_Os08g28450.1 | downstream_gene_variant ; 852.0bp to feature; MODIFIER | silent_mutation | Average:7.291; most accessible tissue: Callus, score: 23.893 | N | N | N | N |
| vg0817358920 | A -> G | LOC_Os08g28430-LOC_Os08g28450 | intergenic_region ; MODIFIER | silent_mutation | Average:7.291; most accessible tissue: Callus, score: 23.893 | N | N | N | N |
| vg0817358920 | A -> DEL | N | N | silent_mutation | Average:7.291; most accessible tissue: Callus, score: 23.893 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817358920 | 5.96E-06 | NA | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817358920 | NA | 2.43E-06 | mr1229 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817358920 | NA | 2.15E-06 | mr1351 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817358920 | 5.58E-06 | 7.74E-08 | mr1523 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |