Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817355953:

Variant ID: vg0817355953 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17355953
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, C: 0.11, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

CAGAAGGGGGTGAATGGTTGATATGCCTAAAAACCAAAACTTTTAGTGGAAATAAAAGTTACCCTCAAATTCGACGGATCGCGGTCTGACCGAAGTAGTT[C/G]
CACCGGTCTAACCGCCTGGAACACGCCGGTCTGACCGAGATCGAACTCCGGTCGAACCGCTGAGATCGTCTGCCGCTCCCTGTCGCTGCCGCCCGGTGTG

Reverse complement sequence

CACACCGGGCGGCAGCGACAGGGAGCGGCAGACGATCTCAGCGGTTCGACCGGAGTTCGATCTCGGTCAGACCGGCGTGTTCCAGGCGGTTAGACCGGTG[G/C]
AACTACTTCGGTCAGACCGCGATCCGTCGAATTTGAGGGTAACTTTTATTTCCACTAAAAGTTTTGGTTTTTAGGCATATCAACCATTCACCCCCTTCTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.60%	12.00%	14.66%	39.78%	NA
All Indica	2759	3.40%	13.10%	19.50%	64.04%	NA
All Japonica	1512	89.60%	6.40%	0.79%	3.17%	NA
Aus	269	1.10%	37.20%	49.44%	12.27%	NA
Indica I	595	6.70%	6.70%	13.45%	73.11%	NA
Indica II	465	2.60%	8.80%	8.82%	79.78%	NA
Indica III	913	1.40%	21.90%	25.63%	51.04%	NA
Indica Intermediate	786	3.60%	10.20%	23.28%	62.98%	NA
Temperate Japonica	767	94.90%	4.20%	0.26%	0.65%	NA
Tropical Japonica	504	83.30%	7.70%	1.39%	7.54%	NA
Japonica Intermediate	241	85.90%	10.80%	1.24%	2.07%	NA
VI/Aromatic	96	91.70%	1.00%	1.04%	6.25%	NA
Intermediate	90	52.20%	8.90%	10.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817355953	C -> G	LOC_Os08g28430.1	upstream_gene_variant ; 3875.0bp to feature; MODIFIER	silent_mutation	Average:15.523; most accessible tissue: Callus, score: 55.918	N	N	N	N
vg0817355953	C -> G	LOC_Os08g28450.1	downstream_gene_variant ; 3819.0bp to feature; MODIFIER	silent_mutation	Average:15.523; most accessible tissue: Callus, score: 55.918	N	N	N	N
vg0817355953	C -> G	LOC_Os08g28430-LOC_Os08g28450	intergenic_region ; MODIFIER	silent_mutation	Average:15.523; most accessible tissue: Callus, score: 55.918	N	N	N	N
vg0817355953	C -> DEL	N	N	silent_mutation	Average:15.523; most accessible tissue: Callus, score: 55.918	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817355953	NA	9.48E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817355953	NA	5.87E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817355953	NA	6.09E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817355953	NA	9.15E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817355953	NA	3.33E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817355953	5.88E-07	5.88E-07	mr1417_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817355953	NA	2.43E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251