\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817311608:

Variant ID: vg0817311608 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17311608
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACACACCCTTTAGGTGCCCGCACGAGGCTGATAAAGGAAGTCTAACGTTATCTCTGAATTCACCAAGAACGGTCACATGAGCTCGATAACAATTACTC[T/C]
AAGGTCTGCGCGCGGTTGAGAATATGAATTTGTTCATTTGCATCGAAGTCTGGGGCTACTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACT

Reverse complement sequence

AGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGTAGCCCCAGACTTCGATGCAAATGAACAAATTCATATTCTCAACCGCGCGCAGACCTT[A/G]
GAGTAATTGTTATCGAGCTCATGTGACCGTTCTTGGTGAATTCAGAGATAACGTTAGACTTCCTTTATCAGCCTCGTGCGGGCACCTAAAGGGTGTGTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 32.90% 0.21% 5.37% NA
All Indica  2759 88.50% 2.30% 0.22% 8.92% NA
All Japonica  1512 9.60% 89.70% 0.20% 0.46% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 91.60% 3.50% 0.34% 4.54% NA
Indica II  465 96.10% 3.00% 0.00% 0.86% NA
Indica III  913 84.20% 0.70% 0.44% 14.68% NA
Indica Intermediate  786 86.80% 2.90% 0.00% 10.31% NA
Temperate Japonica  767 5.10% 94.40% 0.26% 0.26% NA
Tropical Japonica  504 18.50% 80.40% 0.20% 0.99% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817311608 T -> C LOC_Os08g28380.1 upstream_gene_variant ; 374.0bp to feature; MODIFIER silent_mutation Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0817311608 T -> C LOC_Os08g28360.1 downstream_gene_variant ; 4778.0bp to feature; MODIFIER silent_mutation Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0817311608 T -> C LOC_Os08g28370.1 downstream_gene_variant ; 2588.0bp to feature; MODIFIER silent_mutation Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0817311608 T -> C LOC_Os08g28390.1 downstream_gene_variant ; 2291.0bp to feature; MODIFIER silent_mutation Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0817311608 T -> C LOC_Os08g28370-LOC_Os08g28380 intergenic_region ; MODIFIER silent_mutation Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N
vg0817311608 T -> DEL N N silent_mutation Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817311608 NA 4.52E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608 NA 1.24E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608 NA 9.33E-29 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608 4.98E-07 4.17E-08 mr1167_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608 NA 5.14E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608 NA 1.83E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251