Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0817311608:

Variant ID: vg0817311608 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 17311608
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGACACACCCTTTAGGTGCCCGCACGAGGCTGATAAAGGAAGTCTAACGTTATCTCTGAATTCACCAAGAACGGTCACATGAGCTCGATAACAATTACTC[T/C]
AAGGTCTGCGCGCGGTTGAGAATATGAATTTGTTCATTTGCATCGAAGTCTGGGGCTACTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACT

Reverse complement sequence

AGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGTAGCCCCAGACTTCGATGCAAATGAACAAATTCATATTCTCAACCGCGCGCAGACCTT[A/G]
GAGTAATTGTTATCGAGCTCATGTGACCGTTCTTGGTGAATTCAGAGATAACGTTAGACTTCCTTTATCAGCCTCGTGCGGGCACCTAAAGGGTGTGTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.50%	32.90%	0.21%	5.37%	NA
All Indica	2759	88.50%	2.30%	0.22%	8.92%	NA
All Japonica	1512	9.60%	89.70%	0.20%	0.46%	NA
Aus	269	98.50%	1.10%	0.37%	0.00%	NA
Indica I	595	91.60%	3.50%	0.34%	4.54%	NA
Indica II	465	96.10%	3.00%	0.00%	0.86%	NA
Indica III	913	84.20%	0.70%	0.44%	14.68%	NA
Indica Intermediate	786	86.80%	2.90%	0.00%	10.31%	NA
Temperate Japonica	767	5.10%	94.40%	0.26%	0.26%	NA
Tropical Japonica	504	18.50%	80.40%	0.20%	0.99%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	48.90%	50.00%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0817311608	T -> C	LOC_Os08g28380.1	upstream_gene_variant ; 374.0bp to feature; MODIFIER	silent_mutation	Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0817311608	T -> C	LOC_Os08g28360.1	downstream_gene_variant ; 4778.0bp to feature; MODIFIER	silent_mutation	Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0817311608	T -> C	LOC_Os08g28370.1	downstream_gene_variant ; 2588.0bp to feature; MODIFIER	silent_mutation	Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0817311608	T -> C	LOC_Os08g28390.1	downstream_gene_variant ; 2291.0bp to feature; MODIFIER	silent_mutation	Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0817311608	T -> C	LOC_Os08g28370-LOC_Os08g28380	intergenic_region ; MODIFIER	silent_mutation	Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0817311608	T -> DEL	N	N	silent_mutation	Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0817311608	NA	4.52E-10	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608	NA	1.24E-06	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608	NA	9.33E-29	mr1922	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608	4.98E-07	4.17E-08	mr1167_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608	NA	5.14E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817311608	NA	1.83E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251