| Variant ID: vg0817311608 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17311608 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGACACACCCTTTAGGTGCCCGCACGAGGCTGATAAAGGAAGTCTAACGTTATCTCTGAATTCACCAAGAACGGTCACATGAGCTCGATAACAATTACTC[T/C]
AAGGTCTGCGCGCGGTTGAGAATATGAATTTGTTCATTTGCATCGAAGTCTGGGGCTACTGTCAGGGTTATGGATACCACATACCTAATAGTAGTTGACT
AGTCAACTACTATTAGGTATGTGGTATCCATAACCCTGACAGTAGCCCCAGACTTCGATGCAAATGAACAAATTCATATTCTCAACCGCGCGCAGACCTT[A/G]
GAGTAATTGTTATCGAGCTCATGTGACCGTTCTTGGTGAATTCAGAGATAACGTTAGACTTCCTTTATCAGCCTCGTGCGGGCACCTAAAGGGTGTGTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.50% | 32.90% | 0.21% | 5.37% | NA |
| All Indica | 2759 | 88.50% | 2.30% | 0.22% | 8.92% | NA |
| All Japonica | 1512 | 9.60% | 89.70% | 0.20% | 0.46% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.60% | 3.50% | 0.34% | 4.54% | NA |
| Indica II | 465 | 96.10% | 3.00% | 0.00% | 0.86% | NA |
| Indica III | 913 | 84.20% | 0.70% | 0.44% | 14.68% | NA |
| Indica Intermediate | 786 | 86.80% | 2.90% | 0.00% | 10.31% | NA |
| Temperate Japonica | 767 | 5.10% | 94.40% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 18.50% | 80.40% | 0.20% | 0.99% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 50.00% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817311608 | T -> C | LOC_Os08g28380.1 | upstream_gene_variant ; 374.0bp to feature; MODIFIER | silent_mutation | Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0817311608 | T -> C | LOC_Os08g28360.1 | downstream_gene_variant ; 4778.0bp to feature; MODIFIER | silent_mutation | Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0817311608 | T -> C | LOC_Os08g28370.1 | downstream_gene_variant ; 2588.0bp to feature; MODIFIER | silent_mutation | Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0817311608 | T -> C | LOC_Os08g28390.1 | downstream_gene_variant ; 2291.0bp to feature; MODIFIER | silent_mutation | Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0817311608 | T -> C | LOC_Os08g28370-LOC_Os08g28380 | intergenic_region ; MODIFIER | silent_mutation | Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| vg0817311608 | T -> DEL | N | N | silent_mutation | Average:45.475; most accessible tissue: Zhenshan97 flag leaf, score: 72.387 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817311608 | NA | 4.52E-10 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817311608 | NA | 1.24E-06 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817311608 | NA | 9.33E-29 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817311608 | 4.98E-07 | 4.17E-08 | mr1167_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817311608 | NA | 5.14E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817311608 | NA | 1.83E-07 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |