\
| Variant ID: vg0817173341 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17173341 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
TAACTTTGAAAGATTATGGTCTTACTTTTGAGAAAGTGCCTCTCTTTTGTGATAATACTACTGCTATAAACATTGCTAAGAATCCTGTACAAAGCATATT[G/A]
ATATTCGCTTTCACTTTTTGAGGGATCATGTTGAGAAGGGTGATGTTGAATTGACGTTTTTGGATACAAAGTTGTAACTTGCTGATATTTTCACTAAACC
GGTTTAGTGAAAATATCAGCAAGTTACAACTTTGTATCCAAAAACGTCAATTCAACATCACCCTTCTCAACATGATCCCTCAAAAAGTGAAAGCGAATAT[C/T]
AATATGCTTTGTACAGGATTCTTAGCAATGTTTATAGCAGTAGTATTATCACAAAAGAGAGGCACTTTCTCAAAAGTAAGACCATAATCTTTCAAAGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 6.00% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 81.40% | 16.90% | 1.72% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 2.30% | 2.74% | 0.00% | NA |
| Tropical Japonica | 504 | 58.50% | 41.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 12.00% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817173341 | G -> A | LOC_Os08g28130.1 | downstream_gene_variant ; 3854.0bp to feature; MODIFIER | silent_mutation | Average:23.445; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0817173341 | G -> A | LOC_Os08g28140.1 | downstream_gene_variant ; 70.0bp to feature; MODIFIER | silent_mutation | Average:23.445; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0817173341 | G -> A | LOC_Os08g28140-LOC_Os08g28150 | intergenic_region ; MODIFIER | silent_mutation | Average:23.445; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817173341 | 3.09E-08 | 2.65E-20 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | NA | 2.61E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | 1.16E-08 | 2.11E-20 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | NA | 2.83E-13 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | 1.21E-08 | 6.50E-22 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | NA | 5.56E-07 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | NA | 3.02E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | 7.56E-08 | 5.23E-21 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | NA | 6.42E-13 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | NA | 2.18E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | 3.37E-08 | 2.91E-15 | mr1993_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817173341 | NA | 1.45E-12 | mr1993_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |