\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0817173341:

Variant ID: vg0817173341 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 17173341
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TAACTTTGAAAGATTATGGTCTTACTTTTGAGAAAGTGCCTCTCTTTTGTGATAATACTACTGCTATAAACATTGCTAAGAATCCTGTACAAAGCATATT[G/A]
ATATTCGCTTTCACTTTTTGAGGGATCATGTTGAGAAGGGTGATGTTGAATTGACGTTTTTGGATACAAAGTTGTAACTTGCTGATATTTTCACTAAACC

Reverse complement sequence

GGTTTAGTGAAAATATCAGCAAGTTACAACTTTGTATCCAAAAACGTCAATTCAACATCACCCTTCTCAACATGATCCCTCAAAAAGTGAAAGCGAATAT[C/T]
AATATGCTTTGTACAGGATTCTTAGCAATGTTTATAGCAGTAGTATTATCACAAAAGAGAGGCACTTTCTCAAAAGTAAGACCATAATCTTTCAAAGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 6.00% 0.61% 0.00% NA
All Indica  2759 99.10% 0.80% 0.07% 0.00% NA
All Japonica  1512 81.40% 16.90% 1.72% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.00% 0.13% 0.00% NA
Temperate Japonica  767 94.90% 2.30% 2.74% 0.00% NA
Tropical Japonica  504 58.50% 41.30% 0.20% 0.00% NA
Japonica Intermediate  241 86.30% 12.00% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0817173341 G -> A LOC_Os08g28130.1 downstream_gene_variant ; 3854.0bp to feature; MODIFIER silent_mutation Average:23.445; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0817173341 G -> A LOC_Os08g28140.1 downstream_gene_variant ; 70.0bp to feature; MODIFIER silent_mutation Average:23.445; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0817173341 G -> A LOC_Os08g28140-LOC_Os08g28150 intergenic_region ; MODIFIER silent_mutation Average:23.445; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0817173341 3.09E-08 2.65E-20 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 NA 2.61E-06 mr1398 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 1.16E-08 2.11E-20 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 NA 2.83E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 1.21E-08 6.50E-22 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 NA 5.56E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 NA 3.02E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 7.56E-08 5.23E-21 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 NA 6.42E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 NA 2.18E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 3.37E-08 2.91E-15 mr1993_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0817173341 NA 1.45E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251