\
| Variant ID: vg0817164286 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 17164286 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCAGGAAGATCCAACCTGGCCAGAGTACGTCTCTCGACGAGATTGGAGTTATCGTCATCAACTATTTGATTCGGCGAGATCGATCAAGCTCCAAGATAT[C/T,A]
ATCGCCGCGAAGGATAATTGTTCAATATCGCCAGATACGAGACTTCGGTTCATGTCGACTACAACGGAACTTGCCGATCTACGATCATAATTGGTCCCGA
TCGGGACCAATTATGATCGTAGATCGGCAAGTTCCGTTGTAGTCGACATGAACCGAAGTCTCGTATCTGGCGATATTGAACAATTATCCTTCGCGGCGAT[G/A,T]
ATATCTTGGAGCTTGATCGATCTCGCCGAATCAAATAGTTGATGACGATAACTCCAATCTCGTCGAGAGACGTACTCTGGCCAGGTTGGATCTTCCTGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.20% | 15.90% | 0.15% | 1.48% | A: 0.19% |
| All Indica | 2759 | 98.60% | 1.00% | 0.04% | 0.00% | A: 0.33% |
| All Japonica | 1512 | 54.50% | 40.70% | 0.33% | 4.43% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 0.20% | 0.00% | 0.00% | A: 0.99% |
| Indica Intermediate | 786 | 98.50% | 1.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 69.10% | 30.50% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 39.10% | 47.80% | 0.40% | 12.70% | NA |
| Japonica Intermediate | 241 | 40.20% | 58.50% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 24.40% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0817164286 | C -> T | LOC_Os08g28130.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.658; most accessible tissue: Zhenshan97 flower, score: 59.202 | N | N | N | N |
| vg0817164286 | C -> A | LOC_Os08g28130.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.658; most accessible tissue: Zhenshan97 flower, score: 59.202 | N | N | N | N |
| vg0817164286 | C -> DEL | N | N | silent_mutation | Average:43.658; most accessible tissue: Zhenshan97 flower, score: 59.202 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0817164286 | 7.58E-07 | NA | mr1006 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817164286 | 9.75E-07 | NA | mr1007 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817164286 | 8.66E-07 | NA | mr1052 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817164286 | 1.68E-07 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817164286 | 5.23E-06 | NA | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817164286 | 2.27E-06 | NA | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817164286 | NA | 2.83E-09 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817164286 | 3.19E-06 | NA | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0817164286 | 8.37E-06 | NA | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |