\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816981965:

Variant ID: vg0816981965 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16981965
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGCCATACCACGTTTAGTTTGTTGCTAAACTTTGGTAAATATATAAGAAATTCTACCAAAACTTGATAATGGTTGATGCCATTTTTTATATATTTTGA[C/T]
AATATTGTTAAGGTTTATTTTAGCTACAATCTGCACAGTCCCTCAGTTCCAACAGTTCGAAGATACTGGCTCAAATAAAGTGTACTTGTTGTATGTGTAT

Reverse complement sequence

ATACACATACAACAAGTACACTTTATTTGAGCCAGTATCTTCGAACTGTTGGAACTGAGGGACTGTGCAGATTGTAGCTAAAATAAACCTTAACAATATT[G/A]
TCAAAATATATAAAAAATGGCATCAACCATTATCAAGTTTTGGTAGAATTTCTTATATATTTACCAAAGTTTAGCAACAAACTAAACGTGGTATGGCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.10% 36.50% 1.18% 14.16% NA
All Indica  2759 69.30% 5.90% 1.52% 23.23% NA
All Japonica  1512 6.70% 92.40% 0.00% 0.93% NA
Aus  269 82.50% 10.80% 4.83% 1.86% NA
Indica I  595 86.10% 3.00% 1.01% 9.92% NA
Indica II  465 66.20% 4.10% 2.80% 26.88% NA
Indica III  913 61.30% 7.60% 1.20% 29.90% NA
Indica Intermediate  786 67.80% 7.30% 1.53% 23.41% NA
Temperate Japonica  767 0.70% 98.70% 0.00% 0.65% NA
Tropical Japonica  504 17.10% 81.50% 0.00% 1.39% NA
Japonica Intermediate  241 4.10% 95.00% 0.00% 0.83% NA
VI/Aromatic  96 6.20% 92.70% 0.00% 1.04% NA
Intermediate  90 36.70% 53.30% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816981965 C -> T LOC_Os08g27850.1 upstream_gene_variant ; 295.0bp to feature; MODIFIER silent_mutation Average:94.834; most accessible tissue: Callus, score: 97.587 N N N N
vg0816981965 C -> T LOC_Os08g27850.2 upstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:94.834; most accessible tissue: Callus, score: 97.587 N N N N
vg0816981965 C -> T LOC_Os08g27840-LOC_Os08g27850 intergenic_region ; MODIFIER silent_mutation Average:94.834; most accessible tissue: Callus, score: 97.587 N N N N
vg0816981965 C -> DEL N N silent_mutation Average:94.834; most accessible tissue: Callus, score: 97.587 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0816981965 C T 0.01 0.02 0.02 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816981965 NA 7.84E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 2.19E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 1.43E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 8.23E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 7.32E-10 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 3.39E-10 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 4.42E-06 NA mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 8.74E-09 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 6.45E-06 6.16E-06 mr1402_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 5.89E-08 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 1.37E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 3.22E-06 1.61E-06 mr1698_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 9.63E-06 5.68E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 6.51E-06 6.08E-06 mr1733_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 1.37E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 NA 8.90E-06 mr1888_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816981965 8.50E-06 NA mr1909_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251