\
| Variant ID: vg0816931318 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16931318 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 92. )
CCTGGCCGCAAGACTTGTGTGATCGTGTAAGGTCCTTCCCATTTTGGTGAGAGTTTGTTTCGCCCTGCTTGGGTTTGAACTCGTTGGAGGACATAGTCGC[T/C]
GATCGAAAGTATGCGTGCTCGGATGCGCTTCTCGTGATAACGGCGGAGGGACTGTTGATAGCTGGATGCTCAGACGGCAACTCGCTCACGATGCTCCTCG
CGAGGAGCATCGTGAGCGAGTTGCCGTCTGAGCATCCAGCTATCAACAGTCCCTCCGCCGTTATCACGAGAAGCGCATCCGAGCACGCATACTTTCGATC[A/G]
GCGACTATGTCCTCCAACGAGTTCAAACCCAAGCAGGGCGAAACAAACTCTCACCAAAATGGGAAGGACCTTACACGATCACACAAGTCTTGCGGCCAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.80% | 28.70% | 23.83% | 11.70% | NA |
| All Indica | 2759 | 24.50% | 37.00% | 23.74% | 14.75% | NA |
| All Japonica | 1512 | 62.40% | 6.30% | 22.35% | 8.99% | NA |
| Aus | 269 | 8.60% | 77.00% | 13.75% | 0.74% | NA |
| Indica I | 595 | 15.10% | 60.50% | 13.78% | 10.59% | NA |
| Indica II | 465 | 20.60% | 12.90% | 38.06% | 28.39% | NA |
| Indica III | 913 | 30.30% | 36.50% | 23.22% | 9.97% | NA |
| Indica Intermediate | 786 | 27.00% | 34.20% | 23.41% | 15.39% | NA |
| Temperate Japonica | 767 | 79.90% | 0.40% | 8.47% | 11.21% | NA |
| Tropical Japonica | 504 | 32.10% | 17.10% | 46.83% | 3.97% | NA |
| Japonica Intermediate | 241 | 69.70% | 2.50% | 15.35% | 12.45% | NA |
| VI/Aromatic | 96 | 19.80% | 8.30% | 69.79% | 2.08% | NA |
| Intermediate | 90 | 36.70% | 24.40% | 32.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816931318 | T -> C | LOC_Os08g27790.1 | downstream_gene_variant ; 795.0bp to feature; MODIFIER | silent_mutation | Average:30.126; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0816931318 | T -> C | LOC_Os08g27800.1 | downstream_gene_variant ; 304.0bp to feature; MODIFIER | silent_mutation | Average:30.126; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0816931318 | T -> C | LOC_Os08g27790-LOC_Os08g27800 | intergenic_region ; MODIFIER | silent_mutation | Average:30.126; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0816931318 | T -> DEL | N | N | silent_mutation | Average:30.126; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816931318 | NA | 6.29E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | NA | 7.84E-06 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | 4.29E-06 | 4.29E-06 | mr1412_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | 9.22E-06 | 4.94E-07 | mr1747_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | 2.80E-06 | NA | mr1764_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | 9.30E-06 | NA | mr1812_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | 2.87E-06 | NA | mr1816_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | NA | 9.20E-07 | mr1831_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | 4.25E-06 | NA | mr1833_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | 6.78E-06 | 2.07E-08 | mr1840_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | 7.18E-06 | 7.22E-06 | mr1847_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816931318 | 5.19E-06 | 3.11E-08 | mr1856_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |