Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0816902702:

Variant ID: vg0816902702 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16902702
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAGAAATTTTGGATTCCTTTGCAAATTTCTCAGGTCTGCAAATAAATTACCATAAGAGCACTCTAGTACCCATACACCTGAATGAGGCAACAAAAACTA[T/C]
GGTGACGCAAATTCTACATTGCCCTGCTAGTTCACTCCCTTGCAGCTACCTTGGGTTACCTCTTTCAACCACAAAAATCTCGCATAACATGCTGCTGCCA

Reverse complement sequence

TGGCAGCAGCATGTTATGCGAGATTTTTGTGGTTGAAAGAGGTAACCCAAGGTAGCTGCAAGGGAGTGAACTAGCAGGGCAATGTAGAATTTGCGTCACC[A/G]
TAGTTTTTGTTGCCTCATTCAGGTGTATGGGTACTAGAGTGCTCTTATGGTAATTTATTTGCAGACCTGAGAAATTTGCAAAGGAATCCAAAATTTCTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.90%	15.60%	2.73%	37.77%	NA
All Indica	2759	37.70%	12.60%	2.57%	47.08%	NA
All Japonica	1512	49.40%	22.60%	3.17%	24.87%	NA
Aus	269	88.50%	3.30%	1.12%	7.06%	NA
Indica I	595	71.10%	2.40%	2.18%	24.37%	NA
Indica II	465	12.00%	15.30%	4.30%	68.39%	NA
Indica III	913	30.00%	18.70%	1.20%	50.05%	NA
Indica Intermediate	786	36.60%	11.70%	3.44%	48.22%	NA
Temperate Japonica	767	66.10%	3.10%	4.17%	26.60%	NA
Tropical Japonica	504	28.00%	57.50%	1.19%	13.29%	NA
Japonica Intermediate	241	41.10%	11.20%	4.15%	43.57%	NA
VI/Aromatic	96	5.20%	24.00%	6.25%	64.58%	NA
Intermediate	90	47.80%	18.90%	1.11%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816902702	T -> C	LOC_Os08g27740.1	upstream_gene_variant ; 3089.0bp to feature; MODIFIER	silent_mutation	Average:71.031; most accessible tissue: Zhenshan97 flower, score: 85.482	N	N	N	N
vg0816902702	T -> C	LOC_Os08g27720-LOC_Os08g27740	intergenic_region ; MODIFIER	silent_mutation	Average:71.031; most accessible tissue: Zhenshan97 flower, score: 85.482	N	N	N	N
vg0816902702	T -> DEL	N	N	silent_mutation	Average:71.031; most accessible tissue: Zhenshan97 flower, score: 85.482	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0816902702	T	C	-0.01	0.0	0.0	0.0	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816902702	NA	7.03E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702	NA	6.01E-08	mr1378	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702	NA	8.10E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702	NA	3.40E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702	NA	9.26E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702	NA	1.10E-18	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702	NA	2.19E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702	NA	1.83E-12	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251