\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816902702:

Variant ID: vg0816902702 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16902702
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGAAATTTTGGATTCCTTTGCAAATTTCTCAGGTCTGCAAATAAATTACCATAAGAGCACTCTAGTACCCATACACCTGAATGAGGCAACAAAAACTA[T/C]
GGTGACGCAAATTCTACATTGCCCTGCTAGTTCACTCCCTTGCAGCTACCTTGGGTTACCTCTTTCAACCACAAAAATCTCGCATAACATGCTGCTGCCA

Reverse complement sequence

TGGCAGCAGCATGTTATGCGAGATTTTTGTGGTTGAAAGAGGTAACCCAAGGTAGCTGCAAGGGAGTGAACTAGCAGGGCAATGTAGAATTTGCGTCACC[A/G]
TAGTTTTTGTTGCCTCATTCAGGTGTATGGGTACTAGAGTGCTCTTATGGTAATTTATTTGCAGACCTGAGAAATTTGCAAAGGAATCCAAAATTTCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.90% 15.60% 2.73% 37.77% NA
All Indica  2759 37.70% 12.60% 2.57% 47.08% NA
All Japonica  1512 49.40% 22.60% 3.17% 24.87% NA
Aus  269 88.50% 3.30% 1.12% 7.06% NA
Indica I  595 71.10% 2.40% 2.18% 24.37% NA
Indica II  465 12.00% 15.30% 4.30% 68.39% NA
Indica III  913 30.00% 18.70% 1.20% 50.05% NA
Indica Intermediate  786 36.60% 11.70% 3.44% 48.22% NA
Temperate Japonica  767 66.10% 3.10% 4.17% 26.60% NA
Tropical Japonica  504 28.00% 57.50% 1.19% 13.29% NA
Japonica Intermediate  241 41.10% 11.20% 4.15% 43.57% NA
VI/Aromatic  96 5.20% 24.00% 6.25% 64.58% NA
Intermediate  90 47.80% 18.90% 1.11% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816902702 T -> C LOC_Os08g27740.1 upstream_gene_variant ; 3089.0bp to feature; MODIFIER silent_mutation Average:71.031; most accessible tissue: Zhenshan97 flower, score: 85.482 N N N N
vg0816902702 T -> C LOC_Os08g27720-LOC_Os08g27740 intergenic_region ; MODIFIER silent_mutation Average:71.031; most accessible tissue: Zhenshan97 flower, score: 85.482 N N N N
vg0816902702 T -> DEL N N silent_mutation Average:71.031; most accessible tissue: Zhenshan97 flower, score: 85.482 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0816902702 T C -0.01 0.0 0.0 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816902702 NA 7.03E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702 NA 6.01E-08 mr1378 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702 NA 8.10E-15 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702 NA 3.40E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702 NA 9.26E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702 NA 1.10E-18 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702 NA 2.19E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816902702 NA 1.83E-12 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251