Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816861360:

Variant ID: vg0816861360 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16861360
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CCTAAATATGCACTACTACAATACCCATTTTTCCGGGCGGTTGAATAGATTATCCCGTGCGGTTGCCCGGCCCGCCTGCAGCTCCTCGTCTGGGAAAATC[T/A]
TTATTTTCGTGTGCGGTCGGCCTGCCCGTACGGGATAATCGATTATCTTGTGCGGTCGGGTTATACGGACCGCACGGGATAATGTATTATCCCATGCGGT

Reverse complement sequence

ACCGCATGGGATAATACATTATCCCGTGCGGTCCGTATAACCCGACCGCACAAGATAATCGATTATCCCGTACGGGCAGGCCGACCGCACACGAAAATAA[A/T]
GATTTTCCCAGACGAGGAGCTGCAGGCGGGCCGGGCAACCGCACGGGATAATCTATTCAACCGCCCGGAAAAATGGGTATTGTAGTAGTGCATATTTAGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.40%	11.60%	10.81%	17.16%	NA
All Indica	2759	33.80%	19.60%	18.05%	28.60%	NA
All Japonica	1512	99.00%	0.00%	0.33%	0.66%	NA
Aus	269	98.10%	0.00%	1.49%	0.37%	NA
Indica I	595	49.70%	35.30%	5.38%	9.58%	NA
Indica II	465	28.40%	5.80%	12.90%	52.90%	NA
Indica III	913	25.30%	15.40%	31.22%	28.04%	NA
Indica Intermediate	786	34.70%	20.60%	15.39%	29.26%	NA
Temperate Japonica	767	99.10%	0.00%	0.26%	0.65%	NA
Tropical Japonica	504	98.60%	0.00%	0.60%	0.79%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	75.60%	8.90%	3.33%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816861360	T -> A	LOC_Os08g27660.1	upstream_gene_variant ; 1137.0bp to feature; MODIFIER	silent_mutation	Average:34.581; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0816861360	T -> A	LOC_Os08g27672.1	downstream_gene_variant ; 2034.0bp to feature; MODIFIER	silent_mutation	Average:34.581; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0816861360	T -> A	LOC_Os08g27674.1	downstream_gene_variant ; 2034.0bp to feature; MODIFIER	silent_mutation	Average:34.581; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0816861360	T -> A	LOC_Os08g27650-LOC_Os08g27660	intergenic_region ; MODIFIER	silent_mutation	Average:34.581; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0816861360	T -> DEL	N	N	silent_mutation	Average:34.581; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816861360	2.39E-06	NA	mr1348	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816861360	5.26E-07	5.26E-07	mr1348	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251