Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816860476:

Variant ID: vg0816860476 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16860476
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACATCATGACTTCACGGTTTTAGCTGTAGAACACTACATGAAGTGACTTTGGGGAGAAAACACTCTGTAAACATGAAAATTAGATCATGGACACCGCGTC[C/T]
ATTAGAATATTTATTTTCGGTTAAATTGAAGAGAGAAATCATGTGAATTCTTTGAAATACCCTAGGTCCACATGTCAAGTCCCCCATCTCTCTATCTCTA

Reverse complement sequence

TAGAGATAGAGAGATGGGGGACTTGACATGTGGACCTAGGGTATTTCAAAGAATTCACATGATTTCTCTCTTCAATTTAACCGAAAATAAATATTCTAAT[G/A]
GACGCGGTGTCCATGATCTAATTTTCATGTTTACAGAGTGTTTTCTCCCCAAAGTCACTTCATGTAGTGTTCTACAGCTAAAACCGTGAAGTCATGATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	31.50%	1.74%	14.56%	NA
All Indica	2759	27.30%	52.40%	2.68%	17.69%	NA
All Japonica	1512	90.30%	1.40%	0.26%	8.00%	NA
Aus	269	72.10%	1.10%	1.49%	25.28%	NA
Indica I	595	46.70%	17.30%	2.52%	33.45%	NA
Indica II	465	23.70%	70.50%	1.51%	4.30%	NA
Indica III	913	13.90%	68.20%	3.50%	14.35%	NA
Indica Intermediate	786	30.20%	49.70%	2.54%	17.56%	NA
Temperate Japonica	767	98.00%	1.00%	0.26%	0.65%	NA
Tropical Japonica	504	84.90%	1.80%	0.20%	13.10%	NA
Japonica Intermediate	241	77.20%	1.70%	0.41%	20.75%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	67.80%	21.10%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816860476	C -> T	LOC_Os08g27660.1	upstream_gene_variant ; 2021.0bp to feature; MODIFIER	silent_mutation	Average:61.047; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0816860476	C -> T	LOC_Os08g27672.1	downstream_gene_variant ; 2918.0bp to feature; MODIFIER	silent_mutation	Average:61.047; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0816860476	C -> T	LOC_Os08g27674.1	downstream_gene_variant ; 2918.0bp to feature; MODIFIER	silent_mutation	Average:61.047; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0816860476	C -> T	LOC_Os08g27650-LOC_Os08g27660	intergenic_region ; MODIFIER	silent_mutation	Average:61.047; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0816860476	C -> DEL	N	N	silent_mutation	Average:61.047; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816860476	NA	1.14E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	3.85E-07	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	4.04E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	8.43E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	4.37E-11	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	4.43E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	3.51E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	1.49E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	2.90E-07	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	8.40E-07	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	1.88E-08	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	2.32E-07	mr1492_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	7.23E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	2.12E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	4.65E-07	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	1.69E-06	mr1556_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	2.18E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	4.39E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	8.45E-07	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	5.16E-07	5.16E-07	mr1764_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	7.40E-08	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	5.41E-06	mr1811_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	9.02E-07	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	1.75E-06	1.75E-06	mr1840_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	4.05E-06	mr1856_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860476	NA	1.82E-07	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251