Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816860448:

Variant ID: vg0816860448 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16860448
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

TTTACCAAATTTCACTGTTAACAACAGGACATCATGACTTCACGGTTTTAGCTGTAGAACACTACATGAAGTGACTTTGGGGAGAAAACACTCTGTAAAC[A/G]
TGAAAATTAGATCATGGACACCGCGTCCATTAGAATATTTATTTTCGGTTAAATTGAAGAGAGAAATCATGTGAATTCTTTGAAATACCCTAGGTCCACA

Reverse complement sequence

TGTGGACCTAGGGTATTTCAAAGAATTCACATGATTTCTCTCTTCAATTTAACCGAAAATAAATATTCTAATGGACGCGGTGTCCATGATCTAATTTTCA[T/C]
GTTTACAGAGTGTTTTCTCCCCAAAGTCACTTCATGTAGTGTTCTACAGCTAAAACCGTGAAGTCATGATGTCCTGTTGTTAACAGTGAAATTTGGTAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.80%	14.50%	4.87%	27.87%	NA
All Indica	2759	28.20%	24.40%	7.83%	39.58%	NA
All Japonica	1512	90.30%	0.20%	0.46%	9.06%	NA
Aus	269	72.50%	0.70%	2.23%	24.54%	NA
Indica I	595	46.70%	5.40%	4.37%	43.53%	NA
Indica II	465	24.70%	26.90%	11.83%	36.56%	NA
Indica III	913	16.00%	36.70%	7.12%	40.20%	NA
Indica Intermediate	786	30.50%	22.90%	8.91%	37.66%	NA
Temperate Japonica	767	98.20%	0.10%	0.26%	1.43%	NA
Tropical Japonica	504	84.70%	0.40%	0.60%	14.29%	NA
Japonica Intermediate	241	76.80%	0.00%	0.83%	22.41%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	67.80%	8.90%	1.11%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816860448	A -> G	LOC_Os08g27660.1	upstream_gene_variant ; 2049.0bp to feature; MODIFIER	silent_mutation	Average:58.924; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0816860448	A -> G	LOC_Os08g27672.1	downstream_gene_variant ; 2946.0bp to feature; MODIFIER	silent_mutation	Average:58.924; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0816860448	A -> G	LOC_Os08g27674.1	downstream_gene_variant ; 2946.0bp to feature; MODIFIER	silent_mutation	Average:58.924; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0816860448	A -> G	LOC_Os08g27650-LOC_Os08g27660	intergenic_region ; MODIFIER	silent_mutation	Average:58.924; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0816860448	A -> DEL	N	N	silent_mutation	Average:58.924; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816860448	NA	8.40E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	9.37E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	4.13E-07	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	3.74E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	8.53E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	4.27E-11	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	2.42E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	1.75E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	1.46E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	1.66E-07	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	5.81E-07	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	1.15E-08	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	1.38E-07	mr1492_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	9.48E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	2.50E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	2.16E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	3.00E-07	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	9.24E-06	1.19E-06	mr1556_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	3.87E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	1.92E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	3.43E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	9.22E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	5.52E-07	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	3.37E-07	3.37E-07	mr1764_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	5.32E-08	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	3.33E-06	mr1811_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	7.23E-07	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	2.56E-06	2.56E-06	mr1840_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	5.22E-06	mr1856_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816860448	NA	6.90E-08	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251