Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816789012:

Variant ID: vg0816789012 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16789012
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.71, A: 0.29, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

CATCCAGTCGTCCATCCCATGATGAGGACAGGCGGCCACATACTCCTGAAGTCGTTCCCACGCCTCAGGAATGGACTCGTCCCTTGTCTGCTGGAAACTC[A/G]
AAATTCTTCCGTGAAGGGCATTGGTTTTGCCCATCGGAAAGAACATTAAGAGGAATGCCGTGGAGCATCTGTCCTAAGTGTTGATTGTAGCACGGTTGGC

Reverse complement sequence

GCCAACCGTGCTACAATCAACACTTAGGACAGATGCTCCACGGCATTCCTCTTAATGTTCTTTCCGATGGGCAAAACCAATGCCCTTCACGGAAGAATTT[T/C]
GAGTTTCCAGCAGACAAGGGACGAGTCCATTCCTGAGGCGTGGGAACGACTTCAGGAGTATGTGGCCGCCTGTCCTCATCATGGGATGGACGACTGGATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.10%	21.90%	0.44%	28.59%	NA
All Indica	2759	40.20%	11.40%	0.72%	47.73%	NA
All Japonica	1512	53.20%	45.60%	0.07%	1.12%	NA
Aus	269	97.80%	0.40%	0.00%	1.86%	NA
Indica I	595	72.80%	13.60%	0.84%	12.77%	NA
Indica II	465	16.10%	22.80%	1.72%	59.35%	NA
Indica III	913	29.00%	1.80%	0.22%	69.00%	NA
Indica Intermediate	786	42.60%	14.10%	0.64%	42.62%	NA
Temperate Japonica	767	35.30%	63.80%	0.13%	0.78%	NA
Tropical Japonica	504	80.20%	18.10%	0.00%	1.79%	NA
Japonica Intermediate	241	53.90%	45.20%	0.00%	0.83%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	55.60%	32.20%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816789012	A -> G	LOC_Os08g27500.1	upstream_gene_variant ; 3201.0bp to feature; MODIFIER	silent_mutation	Average:33.541; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0816789012	A -> G	LOC_Os08g27520.1	downstream_gene_variant ; 2140.0bp to feature; MODIFIER	silent_mutation	Average:33.541; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0816789012	A -> G	LOC_Os08g27530.1	downstream_gene_variant ; 4236.0bp to feature; MODIFIER	silent_mutation	Average:33.541; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0816789012	A -> G	LOC_Os08g27500-LOC_Os08g27520	intergenic_region ; MODIFIER	silent_mutation	Average:33.541; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N
vg0816789012	A -> DEL	N	N	silent_mutation	Average:33.541; most accessible tissue: Zhenshan97 flag leaf, score: 72.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816789012	NA	4.85E-06	mr1060	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816789012	9.49E-06	8.28E-06	mr1668	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816789012	1.19E-07	1.19E-07	mr1819	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251