\
| Variant ID: vg0816756907 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16756907 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 113. )
GTACCCAAGCTATGAACAGGGGCACAAAAAATTGGGTACAACTCTAGAATTGTTGCAACGGAAGGCCAAAAATGGTGTCAGTGACAAGGCATTTGGCGAG[C/T]
TATTGAAACTAGTGAAGAACATTCTTCCAGAGGAAAACAAGTTGCCCGAAACAACATACGAAGCAAAGAAGATAGTCTGCCCTCTAGGACTTGAGATTCA
TGAATCTCAAGTCCTAGAGGGCAGACTATCTTCTTTGCTTCGTATGTTGTTTCGGGCAACTTGTTTTCCTCTGGAAGAATGTTCTTCACTAGTTTCAATA[G/A]
CTCGCCAAATGCCTTGTCACTGACACCATTTTTGGCCTTCCGTTGCAACAATTCTAGAGTTGTACCCAATTTTTTGTGCCCCTGTTCATAGCTTGGGTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.60% | 21.30% | 2.71% | 9.39% | NA |
| All Indica | 2759 | 47.10% | 35.80% | 3.04% | 14.06% | NA |
| All Japonica | 1512 | 95.10% | 0.70% | 1.59% | 2.65% | NA |
| Aus | 269 | 90.30% | 1.10% | 5.95% | 2.60% | NA |
| Indica I | 595 | 81.30% | 8.10% | 2.52% | 8.07% | NA |
| Indica II | 465 | 32.30% | 54.00% | 4.30% | 9.46% | NA |
| Indica III | 913 | 30.30% | 46.70% | 3.07% | 19.93% | NA |
| Indica Intermediate | 786 | 49.50% | 33.30% | 2.67% | 14.50% | NA |
| Temperate Japonica | 767 | 98.20% | 0.10% | 0.39% | 1.30% | NA |
| Tropical Japonica | 504 | 94.60% | 1.80% | 2.58% | 0.99% | NA |
| Japonica Intermediate | 241 | 86.30% | 0.00% | 3.32% | 10.37% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 80.00% | 6.70% | 4.44% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816756907 | C -> T | LOC_Os08g27450.1 | synonymous_variant ; p.Leu169Leu; LOW | synonymous_codon | Average:22.894; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| vg0816756907 | C -> DEL | LOC_Os08g27450.1 | N | frameshift_variant | Average:22.894; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816756907 | NA | 1.09E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816756907 | 3.33E-06 | 3.33E-06 | mr1081_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816756907 | NA | 4.89E-06 | mr1256_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816756907 | NA | 5.49E-06 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816756907 | 4.43E-06 | 4.43E-06 | mr1736_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |