Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0816724411:

Variant ID: vg0816724411 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16724411
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTGTATATAATCAACACAACAAATTCACTAGAAATTTTGGCATGACCTCCCCTCTTTTTTGAAGAAATTTTGAAGCTTGCTTGGGCTGGAGGAGGAA[G/A]
AAGACATATATATAGGGGTGGGACTTTACTCCCGGTTGGTGTTATGAACCGGGGCTAAAGATCGCCGGGATCTTTATTCTCGGTTGGTGTTACCAACCGG

Reverse complement sequence

CCGGTTGGTAACACCAACCGAGAATAAAGATCCCGGCGATCTTTAGCCCCGGTTCATAACACCAACCGGGAGTAAAGTCCCACCCCTATATATATGTCTT[C/T]
TTCCTCCTCCAGCCCAAGCAAGCTTCAAAATTTCTTCAAAAAAGAGGGGAGGTCATGCCAAAATTTCTAGTGAATTTGTTGTGTTGATTATATACAAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.70%	14.70%	8.76%	42.83%	NA
All Indica	2759	25.00%	1.30%	9.89%	63.79%	NA
All Japonica	1512	51.40%	37.10%	2.78%	8.73%	NA
Aus	269	33.10%	0.40%	29.00%	37.55%	NA
Indica I	595	16.60%	0.30%	7.39%	75.63%	NA
Indica II	465	22.40%	3.20%	10.75%	63.66%	NA
Indica III	913	35.30%	0.20%	10.19%	54.33%	NA
Indica Intermediate	786	21.00%	2.20%	10.94%	65.90%	NA
Temperate Japonica	767	68.20%	29.50%	1.30%	1.04%	NA
Tropical Japonica	504	24.00%	48.20%	5.16%	22.62%	NA
Japonica Intermediate	241	55.20%	38.20%	2.49%	4.15%	NA
VI/Aromatic	96	7.30%	74.00%	15.62%	3.12%	NA
Intermediate	90	32.20%	30.00%	6.67%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816724411	G -> A	LOC_Os08g27400.1	upstream_gene_variant ; 803.0bp to feature; MODIFIER	silent_mutation	Average:7.181; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0816724411	G -> A	LOC_Os08g27410.1	upstream_gene_variant ; 4830.0bp to feature; MODIFIER	silent_mutation	Average:7.181; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0816724411	G -> A	LOC_Os08g27390.1	downstream_gene_variant ; 3106.0bp to feature; MODIFIER	silent_mutation	Average:7.181; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0816724411	G -> A	LOC_Os08g27400-LOC_Os08g27410	intergenic_region ; MODIFIER	silent_mutation	Average:7.181; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N
vg0816724411	G -> DEL	N	N	silent_mutation	Average:7.181; most accessible tissue: Minghui63 root, score: 13.235	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816724411	1.42E-07	NA	mr1410	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816724411	3.20E-07	NA	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251