\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816546085:

Variant ID: vg0816546085 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16546085
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCAAGCATATGAACGATCTCGATTACATCATCTCCTACTCGTCAATGAACTGCCACAGCTATATGTAAGACTATTTCTTCGACATATTAAAAATTGGAT[G/A]
TAGATCGATAAAAGAGTAAGGGTGGTCCAAAGTGAAATAAAGGTAAAAATACCCGGTCCAAAGTGAAAACATTAGTCCTAAGGTGGTCCAAAGCGAAACA

Reverse complement sequence

TGTTTCGCTTTGGACCACCTTAGGACTAATGTTTTCACTTTGGACCGGGTATTTTTACCTTTATTTCACTTTGGACCACCCTTACTCTTTTATCGATCTA[C/T]
ATCCAATTTTTAATATGTCGAAGAAATAGTCTTACATATAGCTGTGGCAGTTCATTGACGAGTAGGAGATGATGTAATCGAGATCGTTCATATGCTTGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 41.70% 0.04% 0.00% NA
All Indica  2759 86.80% 13.10% 0.07% 0.00% NA
All Japonica  1512 8.10% 91.90% 0.00% 0.00% NA
Aus  269 72.10% 27.90% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 92.70% 7.30% 0.00% 0.00% NA
Indica III  913 80.40% 19.40% 0.22% 0.00% NA
Indica Intermediate  786 85.40% 14.60% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 16.50% 83.50% 0.00% 0.00% NA
Japonica Intermediate  241 12.90% 87.10% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816546085 G -> A LOC_Os08g27070.1 upstream_gene_variant ; 3386.0bp to feature; MODIFIER silent_mutation Average:41.035; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0816546085 G -> A LOC_Os08g27080.1 downstream_gene_variant ; 990.0bp to feature; MODIFIER silent_mutation Average:41.035; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0816546085 G -> A LOC_Os08g27090.1 downstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:41.035; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0816546085 G -> A LOC_Os08g27080-LOC_Os08g27090 intergenic_region ; MODIFIER silent_mutation Average:41.035; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816546085 5.63E-06 5.63E-06 mr1040 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816546085 8.84E-07 8.84E-07 mr1362 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816546085 NA 1.01E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816546085 NA 1.73E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816546085 NA 1.07E-12 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816546085 NA 1.52E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251