Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816511732:

Variant ID: vg0816511732 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16511732
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, C: 0.29, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

ATAACATTTGGATGACCTCCTTCGGTCATCCCGGCAAAAGAAAAAAAAGAATCAATACAGGCATTAAGATAGGGATCGATTTTTTCAAGGAAAAAGAACG[G/C]
CTACTCTAAGCCAACGCCATATCAATGTAATGAACAGAAATACAAAACCAAAATGCAATGAAACTTAAACATTTTCACCCCCCACATTTCTTCAGGTTTG

Reverse complement sequence

CAAACCTGAAGAAATGTGGGGGGTGAAAATGTTTAAGTTTCATTGCATTTTGGTTTTGTATTTCTGTTCATTACATTGATATGGCGTTGGCTTAGAGTAG[C/G]
CGTTCTTTTTCCTTGAAAAAATCGATCCCTATCTTAATGCCTGTATTGATTCTTTTTTTTCTTTTGCCGGGATGACCGAAGGAGGTCATCCAAATGTTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.30%	20.70%	0.00%	0.00%	NA
All Indica	2759	77.70%	22.30%	0.00%	0.00%	NA
All Japonica	1512	91.10%	8.90%	0.00%	0.00%	NA
Aus	269	25.30%	74.70%	0.00%	0.00%	NA
Indica I	595	71.90%	28.10%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	70.20%	29.80%	0.00%	0.00%	NA
Indica Intermediate	786	78.60%	21.40%	0.00%	0.00%	NA
Temperate Japonica	767	95.00%	5.00%	0.00%	0.00%	NA
Tropical Japonica	504	82.90%	17.10%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816511732	G -> C	LOC_Os08g27020.1	upstream_gene_variant ; 950.0bp to feature; MODIFIER	silent_mutation	Average:62.797; most accessible tissue: Callus, score: 82.545	N	N	N	N
vg0816511732	G -> C	LOC_Os08g27010.1	downstream_gene_variant ; 1406.0bp to feature; MODIFIER	silent_mutation	Average:62.797; most accessible tissue: Callus, score: 82.545	N	N	N	N
vg0816511732	G -> C	LOC_Os08g27030.1	downstream_gene_variant ; 1994.0bp to feature; MODIFIER	silent_mutation	Average:62.797; most accessible tissue: Callus, score: 82.545	N	N	N	N
vg0816511732	G -> C	LOC_Os08g27030.2	downstream_gene_variant ; 2000.0bp to feature; MODIFIER	silent_mutation	Average:62.797; most accessible tissue: Callus, score: 82.545	N	N	N	N
vg0816511732	G -> C	LOC_Os08g27010-LOC_Os08g27020	intergenic_region ; MODIFIER	silent_mutation	Average:62.797; most accessible tissue: Callus, score: 82.545	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816511732	NA	1.33E-07	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816511732	4.65E-06	4.65E-06	mr1065_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816511732	NA	6.28E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816511732	NA	5.19E-06	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816511732	NA	2.27E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816511732	NA	4.79E-06	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816511732	7.84E-06	4.04E-08	mr1403_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816511732	NA	7.19E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816511732	NA	9.17E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251