\
| Variant ID: vg0816453653 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16453653 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 313. )
ACCATTCATTAAAACAACAGATATGCTCTTTGTTGATCTAGATATCCTGTTGACTCTTGTTTTCATGTCCAACCCTCGCTAAATTATCTTCAAAGTATGG[C/T]
GCAACTTCTGTCATATGATAGAGGATAGTAAAATGGGCCTGGCCATACTCGTCTTGATCTGATACAGTTCTTTTTCTGCCTAATGTGGCAATACCGGATA
TATCCGGTATTGCCACATTAGGCAGAAAAAGAACTGTATCAGATCAAGACGAGTATGGCCAGGCCCATTTTACTATCCTCTATCATATGACAGAAGTTGC[G/A]
CCATACTTTGAAGATAATTTAGCGAGGGTTGGACATGAAAACAAGAGTCAACAGGATATCTAGATCAACAAAGAGCATATCTGTTGTTTTAATGAATGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.70% | 1.90% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 93.80% | 5.80% | 0.40% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.00% | 1.49% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 82.90% | 16.50% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816453653 | C -> T | LOC_Os08g26950.1 | downstream_gene_variant ; 804.0bp to feature; MODIFIER | silent_mutation | Average:48.413; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| vg0816453653 | C -> T | LOC_Os08g26950-LOC_Os08g26960 | intergenic_region ; MODIFIER | silent_mutation | Average:48.413; most accessible tissue: Zhenshan97 young leaf, score: 81.6 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816453653 | NA | 8.91E-07 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816453653 | 8.68E-06 | NA | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816453653 | 4.11E-06 | NA | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816453653 | 2.59E-06 | 8.50E-07 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816453653 | NA | 8.22E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816453653 | 1.49E-08 | NA | mr1301_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816453653 | 1.70E-06 | NA | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816453653 | 2.77E-06 | NA | mr1993_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |