\
| Variant ID: vg0816293722 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16293722 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCAAGCAGGGAACATGAATTATTTAAGCAGAACCAGAATCCAGAATATTAAAACAAGAATAACATCGTACACATAAGATCAACTTGAAATCTAAATGGCG[T/A]
GAACAATAATATGAACATAAGCAGTTAATTATCACGTAGAAATATATCAGAAACAAATAGATAGAGTAAACAATCCATGAATAACTCAATTTGTTCGTCA
TGACGAACAAATTGAGTTATTCATGGATTGTTTACTCTATCTATTTGTTTCTGATATATTTCTACGTGATAATTAACTGCTTATGTTCATATTATTGTTC[A/T]
CGCCATTTAGATTTCAAGTTGATCTTATGTGTACGATGTTATTCTTGTTTTAATATTCTGGATTCTGGTTCTGCTTAAATAATTCATGTTCCCTGCTTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.20% | 0.20% | 6.47% | 60.11% | NA |
| All Indica | 2759 | 9.50% | 0.00% | 8.23% | 82.28% | NA |
| All Japonica | 1512 | 73.50% | 0.70% | 2.05% | 23.68% | NA |
| Aus | 269 | 20.10% | 0.00% | 16.73% | 63.20% | NA |
| Indica I | 595 | 8.20% | 0.00% | 8.74% | 83.03% | NA |
| Indica II | 465 | 9.90% | 0.00% | 2.15% | 87.96% | NA |
| Indica III | 913 | 10.00% | 0.00% | 11.28% | 78.75% | NA |
| Indica Intermediate | 786 | 9.70% | 0.00% | 7.89% | 82.44% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.00% | 2.09% | NA |
| Tropical Japonica | 504 | 36.30% | 2.20% | 4.96% | 56.55% | NA |
| Japonica Intermediate | 241 | 73.90% | 0.00% | 2.49% | 23.65% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 52.20% | 0.00% | 3.33% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816293722 | T -> A | LOC_Os08g26800-LOC_Os08g26810 | intergenic_region ; MODIFIER | silent_mutation | Average:15.702; most accessible tissue: Callus, score: 40.648 | N | N | N | N |
| vg0816293722 | T -> DEL | N | N | silent_mutation | Average:15.702; most accessible tissue: Callus, score: 40.648 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816293722 | 4.73E-06 | NA | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | 3.05E-06 | NA | mr1017 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | 1.03E-06 | NA | mr1055 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | NA | 2.41E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | NA | 6.39E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | 8.94E-06 | NA | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | 8.82E-06 | NA | mr1023_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | 9.52E-09 | NA | mr1055_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | 4.13E-07 | NA | mr1132_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | 7.01E-06 | NA | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816293722 | 2.70E-06 | NA | mr1490_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |