Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816277263:

Variant ID: vg0816277263 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16277263
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGTACCTCAAGAACGGCTGGCTCCCGGAGGACGAAGCAGAAGCAAAACGCCTACAGCTTAGAGCCGCAAAATACAAGCTGGTCTCGGGACAGCTATATC[A/G]
CTCCAGGGTGCTCCAACCCTTGCTTTGCTGCATCTCCTTTGCCTAAGGTGAGGAAATGGCGAAAGAAATACACCAGGGGCTCTGTGGTGTGCACCAGGCC

Reverse complement sequence

GGCCTGGTGCACACCACAGAGCCCCTGGTGTATTTCTTTCGCCATTTCCTCACCTTAGGCAAAGGAGATGCAGCAAAGCAAGGGTTGGAGCACCCTGGAG[T/C]
GATATAGCTGTCCCGAGACCAGCTTGTATTTTGCGGCTCTAAGCTGTAGGCGTTTTGCTTCTGCTTCGTCCTCCGGGAGCCAGCCGTTCTTGAGGTACTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	47.50%	1.71%	1.08%	NA
All Indica	2759	78.20%	21.10%	0.69%	0.04%	NA
All Japonica	1512	6.70%	87.80%	2.65%	2.84%	NA
Aus	269	22.70%	68.00%	7.43%	1.86%	NA
Indica I	595	55.80%	42.70%	1.34%	0.17%	NA
Indica II	465	79.60%	19.40%	1.08%	0.00%	NA
Indica III	913	94.90%	4.80%	0.33%	0.00%	NA
Indica Intermediate	786	75.10%	24.60%	0.38%	0.00%	NA
Temperate Japonica	767	0.50%	99.00%	0.39%	0.13%	NA
Tropical Japonica	504	17.70%	70.00%	6.35%	5.95%	NA
Japonica Intermediate	241	3.30%	89.60%	2.07%	4.98%	NA
VI/Aromatic	96	4.20%	94.80%	0.00%	1.04%	NA
Intermediate	90	30.00%	66.70%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816277263	A -> G	LOC_Os08g26780.1	upstream_gene_variant ; 56.0bp to feature; MODIFIER	silent_mutation	Average:24.893; most accessible tissue: Callus, score: 55.027	N	N	N	N
vg0816277263	A -> G	LOC_Os08g26800.1	upstream_gene_variant ; 4399.0bp to feature; MODIFIER	silent_mutation	Average:24.893; most accessible tissue: Callus, score: 55.027	N	N	N	N
vg0816277263	A -> G	LOC_Os08g26760.1	downstream_gene_variant ; 2674.0bp to feature; MODIFIER	silent_mutation	Average:24.893; most accessible tissue: Callus, score: 55.027	N	N	N	N
vg0816277263	A -> G	LOC_Os08g26770.1	downstream_gene_variant ; 479.0bp to feature; MODIFIER	silent_mutation	Average:24.893; most accessible tissue: Callus, score: 55.027	N	N	N	N
vg0816277263	A -> G	LOC_Os08g26790.1	downstream_gene_variant ; 1085.0bp to feature; MODIFIER	silent_mutation	Average:24.893; most accessible tissue: Callus, score: 55.027	N	N	N	N
vg0816277263	A -> G	LOC_Os08g26770-LOC_Os08g26780	intergenic_region ; MODIFIER	silent_mutation	Average:24.893; most accessible tissue: Callus, score: 55.027	N	N	N	N
vg0816277263	A -> DEL	N	N	silent_mutation	Average:24.893; most accessible tissue: Callus, score: 55.027	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816277263	NA	1.08E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	9.66E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	9.25E-19	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	2.58E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	7.90E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	1.65E-06	NA	mr1020_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	1.02E-15	mr1040_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	3.19E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	1.50E-10	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	6.34E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	4.74E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	9.56E-15	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	5.31E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	3.58E-06	mr1915_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816277263	NA	2.00E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251