\
| Variant ID: vg0816277211 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16277211 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGCCAGACAGAGCTGGGCGAAGACCTAGAGGACTAGCGAACCCCATTCGTAAAGTACCTCAAGAACGGCTGGCTCCCGGAGGACGAAGCAGAAGCAAAA[C/T]
GCCTACAGCTTAGAGCCGCAAAATACAAGCTGGTCTCGGGACAGCTATATCACTCCAGGGTGCTCCAACCCTTGCTTTGCTGCATCTCCTTTGCCTAAGG
CCTTAGGCAAAGGAGATGCAGCAAAGCAAGGGTTGGAGCACCCTGGAGTGATATAGCTGTCCCGAGACCAGCTTGTATTTTGCGGCTCTAAGCTGTAGGC[G/A]
TTTTGCTTCTGCTTCGTCCTCCGGGAGCCAGCCGTTCTTGAGGTACTTTACGAATGGGGTTCGCTAGTCCTCTAGGTCTTCGCCCAGCTCTGTCTGGCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.60% | 45.70% | 0.99% | 2.71% | NA |
| All Indica | 2759 | 23.00% | 76.00% | 0.87% | 0.14% | NA |
| All Japonica | 1512 | 91.00% | 1.10% | 0.46% | 7.41% | NA |
| Aus | 269 | 82.20% | 9.70% | 4.83% | 3.35% | NA |
| Indica I | 595 | 42.90% | 55.50% | 1.34% | 0.34% | NA |
| Indica II | 465 | 22.80% | 76.10% | 1.08% | 0.00% | NA |
| Indica III | 913 | 6.60% | 92.30% | 0.99% | 0.11% | NA |
| Indica Intermediate | 786 | 27.20% | 72.40% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 98.60% | 0.50% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 82.10% | 1.60% | 0.99% | 15.28% | NA |
| Japonica Intermediate | 241 | 85.50% | 2.10% | 0.83% | 11.62% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 73.30% | 22.20% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816277211 | C -> T | LOC_Os08g26780.1 | upstream_gene_variant ; 108.0bp to feature; MODIFIER | silent_mutation | Average:25.447; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277211 | C -> T | LOC_Os08g26800.1 | upstream_gene_variant ; 4451.0bp to feature; MODIFIER | silent_mutation | Average:25.447; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277211 | C -> T | LOC_Os08g26760.1 | downstream_gene_variant ; 2622.0bp to feature; MODIFIER | silent_mutation | Average:25.447; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277211 | C -> T | LOC_Os08g26770.1 | downstream_gene_variant ; 427.0bp to feature; MODIFIER | silent_mutation | Average:25.447; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277211 | C -> T | LOC_Os08g26790.1 | downstream_gene_variant ; 1137.0bp to feature; MODIFIER | silent_mutation | Average:25.447; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277211 | C -> T | LOC_Os08g26770-LOC_Os08g26780 | intergenic_region ; MODIFIER | silent_mutation | Average:25.447; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| vg0816277211 | C -> DEL | N | N | silent_mutation | Average:25.447; most accessible tissue: Callus, score: 55.027 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816277211 | 4.71E-06 | 1.12E-06 | mr1781_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277211 | 2.25E-06 | 1.96E-07 | mr1786_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816277211 | NA | 3.88E-06 | mr1827_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |