\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816276034:

Variant ID: vg0816276034 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16276034
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGTGTTCACGCGGGCAAGTTGCTGGGTTTTCTTATTTCCTAAAGGGGTATCGAGGCGAACCCCAAGAAAATCGATGCCATTCAGCAAATGAAGCCCCC[A/G]
TCGAGCGTACTCGAAGTACAAAAGGTCGCAGGCCGAATTGCGGCACTCAGTCGATTCCTCTCAAAGGCAGCCGAAAGAGGCTTGCCCTTCTTCATGACCC

Reverse complement sequence

GGGTCATGAAGAAGGGCAAGCCTCTTTCGGCTGCCTTTGAGAGGAATCGACTGAGTGCCGCAATTCGGCCTGCGACCTTTTGTACTTCGAGTACGCTCGA[T/C]
GGGGGCTTCATTTGCTGAATGGCATCGATTTTCTTGGGGTTCGCCTCGATACCCCTTTAGGAAATAAGAAAACCCAGCAACTTGCCCGCGTGAACACCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 44.60% 1.61% 4.59% NA
All Indica  2759 24.30% 74.40% 1.20% 0.11% NA
All Japonica  1512 83.10% 1.30% 1.79% 13.76% NA
Aus  269 87.70% 6.70% 4.09% 1.49% NA
Indica I  595 43.40% 54.60% 1.85% 0.17% NA
Indica II  465 23.00% 75.90% 1.08% 0.00% NA
Indica III  913 9.10% 89.70% 1.10% 0.11% NA
Indica Intermediate  786 28.20% 70.70% 0.89% 0.13% NA
Temperate Japonica  767 98.40% 0.70% 0.13% 0.78% NA
Tropical Japonica  504 61.30% 1.80% 3.37% 33.53% NA
Japonica Intermediate  241 80.10% 2.50% 3.73% 13.69% NA
VI/Aromatic  96 96.90% 1.00% 2.08% 0.00% NA
Intermediate  90 74.40% 20.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816276034 A -> G LOC_Os08g26770.1 synonymous_variant ; p.Pro227Pro; LOW synonymous_codon Average:18.365; most accessible tissue: Callus, score: 53.972 N N N N
vg0816276034 A -> DEL LOC_Os08g26770.1 N frameshift_variant Average:18.365; most accessible tissue: Callus, score: 53.972 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816276034 1.22E-06 5.37E-06 mr1040_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 8.18E-06 2.14E-06 mr1045_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 4.56E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 1.70E-06 4.70E-07 mr1177_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 8.68E-06 mr1205_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 2.17E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 1.78E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 4.22E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 4.06E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 2.53E-06 9.10E-07 mr1482_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 4.78E-06 NA mr1566_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 1.14E-06 1.14E-06 mr1597_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 5.20E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 6.97E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 3.78E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 8.11E-06 3.47E-07 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 1.73E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 6.27E-08 NA mr1789_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 8.46E-06 NA mr1874_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816276034 NA 2.34E-06 mr1887_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251