\
| Variant ID: vg0816275999 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16275999 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 89. )
CGCGGGTATAAAACTAAATCCGGAAAAGTGTGGTTTTGGTGTTCACGCGGGCAAGTTGCTGGGTTTTCTTATTTCCTAAAGGGGTATCGAGGCGAACCCC[A/G]
AGAAAATCGATGCCATTCAGCAAATGAAGCCCCCATCGAGCGTACTCGAAGTACAAAAGGTCGCAGGCCGAATTGCGGCACTCAGTCGATTCCTCTCAAA
TTTGAGAGGAATCGACTGAGTGCCGCAATTCGGCCTGCGACCTTTTGTACTTCGAGTACGCTCGATGGGGGCTTCATTTGCTGAATGGCATCGATTTTCT[T/C]
GGGGTTCGCCTCGATACCCCTTTAGGAAATAAGAAAACCCAGCAACTTGCCCGCGTGAACACCAAAACCACACTTTTCCGGATTTAGTTTTATACCCGCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.70% | 40.10% | 10.20% | 5.99% | NA |
| All Indica | 2759 | 67.30% | 20.80% | 11.27% | 0.58% | NA |
| All Japonica | 1512 | 8.10% | 74.70% | 1.32% | 15.87% | NA |
| Aus | 269 | 23.40% | 16.00% | 52.79% | 7.81% | NA |
| Indica I | 595 | 40.20% | 43.90% | 15.13% | 0.84% | NA |
| Indica II | 465 | 67.30% | 21.90% | 10.54% | 0.22% | NA |
| Indica III | 913 | 88.40% | 3.40% | 7.78% | 0.44% | NA |
| Indica Intermediate | 786 | 63.40% | 23.00% | 12.85% | 0.76% | NA |
| Temperate Japonica | 767 | 0.50% | 98.60% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 21.40% | 37.90% | 2.98% | 37.70% | NA |
| Japonica Intermediate | 241 | 4.10% | 75.90% | 2.07% | 17.84% | NA |
| VI/Aromatic | 96 | 2.10% | 95.80% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 22.20% | 63.30% | 8.89% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816275999 | A -> G | LOC_Os08g26770.1 | missense_variant ; p.Lys216Glu; MODERATE | nonsynonymous_codon ; K216E | Average:16.753; most accessible tissue: Callus, score: 53.972 | benign |
-0.278 |
TOLERATED | 1.00 |
| vg0816275999 | A -> DEL | LOC_Os08g26770.1 | N | frameshift_variant | Average:16.753; most accessible tissue: Callus, score: 53.972 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816275999 | NA | 3.96E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0816275999 | NA | 1.44E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 3.51E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 5.59E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 2.12E-24 | mr1217 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 2.61E-22 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 2.23E-14 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 2.58E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 2.23E-14 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 7.21E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 4.19E-22 | mr1845 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 6.00E-06 | mr1884 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 6.73E-07 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 6.42E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816275999 | NA | 2.39E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |