Search for Variation information by Variation ID:
Detailed information for vg0816260638:
| Variant ID: vg0816260638 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16260638 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 73. )
Flanking Sequence (100 bp) in Reference Genome:
TCATTTGCGAGTGATGGAAGTGACATATCTAACATATTGTTCTTCTTATTTTGGGGACTGTTCTGAACTTCCTGTAAAACATCAGTGATAGGAGGCACAA[G/A]
CATAGCTTGTTGCCCCGTTGGGTTCTCCAAAATTTTGCGCTCAACGTTGCAAGCAAGCATGAACAATTGGCCTATATGATTATATGTCACATTATCAAAC
Reverse complement sequence
GTTTGATAATGTGACATATAATCATATAGGCCAATTGTTCATGCTTGCTTGCAACGTTGAGCGCAAAATTTTGGAGAACCCAACGGGGCAACAAGCTATG[C/T]
TTGTGCCTCCTATCACTGATGTTTTACAGGAAGTTCAGAACAGTCCCCAAAATAAGAAGAACAATATGTTAGATATGTCACTTCCATCACTCGCAAATGA
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.40% | 7.80% | 5.97% | 59.88% | NA |
| All Indica | 2759 | 11.20% | 1.70% | 8.52% | 78.58% | NA |
| All Japonica | 1512 | 57.70% | 14.30% | 1.85% | 26.12% | NA |
| Aus | 269 | 9.70% | 1.50% | 5.20% | 83.64% | NA |
| Indica I | 595 | 25.50% | 2.70% | 15.97% | 55.80% | NA |
| Indica II | 465 | 10.50% | 2.60% | 10.54% | 76.34% | NA |
| Indica III | 913 | 2.50% | 0.20% | 0.99% | 96.28% | NA |
| Indica Intermediate | 786 | 10.80% | 2.20% | 10.43% | 76.59% | NA |
| Temperate Japonica | 767 | 73.10% | 24.40% | 0.91% | 1.56% | NA |
| Tropical Japonica | 504 | 32.50% | 0.40% | 2.98% | 64.09% | NA |
| Japonica Intermediate | 241 | 61.40% | 11.20% | 2.49% | 24.90% | NA |
| VI/Aromatic | 96 | 5.20% | 87.50% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 37.80% | 17.80% | 5.56% | 38.89% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816260638 | G -> A | LOC_Os08g26730.1 | missense_variant ; p.Leu75Phe; MODERATE | nonsynonymous_codon ; L75F | Average:8.023; most accessible tissue: Callus, score: 35.198 | possibly damaging  |
1.874 |
DELETERIOUS | 0.01 |
| vg0816260638 | G -> DEL | LOC_Os08g26730.1 | N | frameshift_variant | Average:8.023; most accessible tissue: Callus, score: 35.198 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816260638 | 2.30E-06 | 4.96E-27 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0816260638 | NA | 1.02E-07 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0816260638 | NA | 2.27E-08 | mr1006 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816260638 | NA | 1.40E-07 | mr1007 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816260638 | NA | 2.17E-08 | mr1052 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |