\
| Variant ID: vg0816239139 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16239139 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )
GCCGCAGAAGTATGTACTGCTCATGCATCTGTACTGTTCAGAAAACAAAATGTATTTTAGATAGGCTGGCAACAATCACGAGAACAATTCCACTTAAATT[G/T]
CTCTGTTGATCCCAAAGTTTCAGAACAAGAGCTAAATCTCAAGTAGAAAAAGCTCCTGGGAGAACTCAATGATGAAGAAAATACAAATGCAAAATATTTA
TAAATATTTTGCATTTGTATTTTCTTCATCATTGAGTTCTCCCAGGAGCTTTTTCTACTTGAGATTTAGCTCTTGTTCTGAAACTTTGGGATCAACAGAG[C/A]
AATTTAAGTGGAATTGTTCTCGTGATTGTTGCCAGCCTATCTAAAATACATTTTGTTTTCTGAACAGTACAGATGCATGAGCAGTACATACTTCTGCGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.50% | 3.90% | 0.83% | 8.80% | NA |
| All Indica | 2759 | 92.50% | 6.30% | 0.87% | 0.25% | NA |
| All Japonica | 1512 | 74.00% | 0.20% | 0.79% | 25.00% | NA |
| Aus | 269 | 90.00% | 0.00% | 1.12% | 8.92% | NA |
| Indica I | 595 | 98.50% | 0.00% | 1.18% | 0.34% | NA |
| Indica II | 465 | 92.70% | 5.60% | 1.29% | 0.43% | NA |
| Indica III | 913 | 88.10% | 11.10% | 0.77% | 0.11% | NA |
| Indica Intermediate | 786 | 93.10% | 6.10% | 0.51% | 0.25% | NA |
| Temperate Japonica | 767 | 97.80% | 0.00% | 0.13% | 2.09% | NA |
| Tropical Japonica | 504 | 49.40% | 0.60% | 1.98% | 48.02% | NA |
| Japonica Intermediate | 241 | 49.80% | 0.00% | 0.41% | 49.79% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816239139 | G -> T | LOC_Os08g26700.1 | missense_variant ; p.Gln121Lys; MODERATE | nonsynonymous_codon ; Q121K | Average:36.569; most accessible tissue: Zhenshan97 panicle, score: 52.263 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0816239139 | G -> DEL | LOC_Os08g26700.1 | N | frameshift_variant | Average:36.569; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816239139 | 9.58E-07 | 3.01E-08 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 3.48E-06 | NA | mr1111 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 2.75E-06 | 1.36E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 1.53E-06 | 5.03E-08 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 2.47E-07 | NA | mr1068_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 2.77E-09 | 4.68E-09 | mr1090_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 5.26E-07 | NA | mr1094_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 5.89E-06 | NA | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 4.76E-07 | NA | mr1111_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 1.85E-07 | 2.66E-07 | mr1121_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 5.10E-07 | NA | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816239139 | 6.82E-09 | 5.94E-10 | mr1211_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |