\
| Variant ID: vg0816234557 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16234557 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 88. )
AGGGAGTGGTCCCAAAGCACTTTTTGACACAATTTGCTACTATGGACTAGCAAATACCAAATGCCAAATTGCCAACTTTTGCTACTAGTGTTTAGATCCA[A/G]
AATAGCAAAAAGTGCTACAAAATGGCAAAACTTTTGCCATTTTGGAGGATCTAAACAGGGCCTTACGTAGAGAGAAACGGAAAAGAGAAATAATGGTAAC
GTTACCATTATTTCTCTTTTCCGTTTCTCTCTACGTAAGGCCCTGTTTAGATCCTCCAAAATGGCAAAAGTTTTGCCATTTTGTAGCACTTTTTGCTATT[T/C]
TGGATCTAAACACTAGTAGCAAAAGTTGGCAATTTGGCATTTGGTATTTGCTAGTCCATAGTAGCAAATTGTGTCAAAAAGTGCTTTGGGACCACTCCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.70% | 0.90% | 0.72% | 57.74% | NA |
| All Indica | 2759 | 22.00% | 1.40% | 1.09% | 75.50% | NA |
| All Japonica | 1512 | 74.30% | 0.00% | 0.20% | 25.46% | NA |
| Aus | 269 | 17.50% | 0.00% | 0.37% | 82.16% | NA |
| Indica I | 595 | 46.70% | 2.20% | 0.84% | 50.25% | NA |
| Indica II | 465 | 23.70% | 1.70% | 1.72% | 72.90% | NA |
| Indica III | 913 | 3.70% | 0.00% | 0.22% | 96.06% | NA |
| Indica Intermediate | 786 | 23.50% | 2.30% | 1.91% | 72.26% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.00% | 1.30% | NA |
| Tropical Japonica | 504 | 36.70% | 0.00% | 0.40% | 62.90% | NA |
| Japonica Intermediate | 241 | 75.50% | 0.00% | 0.41% | 24.07% | NA |
| VI/Aromatic | 96 | 91.70% | 1.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 62.20% | 1.10% | 0.00% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816234557 | A -> G | LOC_Os08g26690.1 | downstream_gene_variant ; 1611.0bp to feature; MODIFIER | silent_mutation | Average:15.111; most accessible tissue: Callus, score: 32.265 | N | N | N | N |
| vg0816234557 | A -> G | LOC_Os08g26700.1 | downstream_gene_variant ; 4026.0bp to feature; MODIFIER | silent_mutation | Average:15.111; most accessible tissue: Callus, score: 32.265 | N | N | N | N |
| vg0816234557 | A -> G | LOC_Os08g26700.2 | downstream_gene_variant ; 2905.0bp to feature; MODIFIER | silent_mutation | Average:15.111; most accessible tissue: Callus, score: 32.265 | N | N | N | N |
| vg0816234557 | A -> G | LOC_Os08g26700.3 | downstream_gene_variant ; 2905.0bp to feature; MODIFIER | silent_mutation | Average:15.111; most accessible tissue: Callus, score: 32.265 | N | N | N | N |
| vg0816234557 | A -> G | LOC_Os08g26690-LOC_Os08g26700 | intergenic_region ; MODIFIER | silent_mutation | Average:15.111; most accessible tissue: Callus, score: 32.265 | N | N | N | N |
| vg0816234557 | A -> DEL | N | N | silent_mutation | Average:15.111; most accessible tissue: Callus, score: 32.265 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816234557 | NA | 1.68E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816234557 | NA | 3.90E-16 | mr1040_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816234557 | 9.25E-06 | NA | mr1134_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816234557 | 4.33E-07 | 8.21E-06 | mr1134_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |