\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816234557:

Variant ID: vg0816234557 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16234557
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGAGTGGTCCCAAAGCACTTTTTGACACAATTTGCTACTATGGACTAGCAAATACCAAATGCCAAATTGCCAACTTTTGCTACTAGTGTTTAGATCCA[A/G]
AATAGCAAAAAGTGCTACAAAATGGCAAAACTTTTGCCATTTTGGAGGATCTAAACAGGGCCTTACGTAGAGAGAAACGGAAAAGAGAAATAATGGTAAC

Reverse complement sequence

GTTACCATTATTTCTCTTTTCCGTTTCTCTCTACGTAAGGCCCTGTTTAGATCCTCCAAAATGGCAAAAGTTTTGCCATTTTGTAGCACTTTTTGCTATT[T/C]
TGGATCTAAACACTAGTAGCAAAAGTTGGCAATTTGGCATTTGGTATTTGCTAGTCCATAGTAGCAAATTGTGTCAAAAAGTGCTTTGGGACCACTCCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.70% 0.90% 0.72% 57.74% NA
All Indica  2759 22.00% 1.40% 1.09% 75.50% NA
All Japonica  1512 74.30% 0.00% 0.20% 25.46% NA
Aus  269 17.50% 0.00% 0.37% 82.16% NA
Indica I  595 46.70% 2.20% 0.84% 50.25% NA
Indica II  465 23.70% 1.70% 1.72% 72.90% NA
Indica III  913 3.70% 0.00% 0.22% 96.06% NA
Indica Intermediate  786 23.50% 2.30% 1.91% 72.26% NA
Temperate Japonica  767 98.70% 0.00% 0.00% 1.30% NA
Tropical Japonica  504 36.70% 0.00% 0.40% 62.90% NA
Japonica Intermediate  241 75.50% 0.00% 0.41% 24.07% NA
VI/Aromatic  96 91.70% 1.00% 0.00% 7.29% NA
Intermediate  90 62.20% 1.10% 0.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816234557 A -> G LOC_Os08g26690.1 downstream_gene_variant ; 1611.0bp to feature; MODIFIER silent_mutation Average:15.111; most accessible tissue: Callus, score: 32.265 N N N N
vg0816234557 A -> G LOC_Os08g26700.1 downstream_gene_variant ; 4026.0bp to feature; MODIFIER silent_mutation Average:15.111; most accessible tissue: Callus, score: 32.265 N N N N
vg0816234557 A -> G LOC_Os08g26700.2 downstream_gene_variant ; 2905.0bp to feature; MODIFIER silent_mutation Average:15.111; most accessible tissue: Callus, score: 32.265 N N N N
vg0816234557 A -> G LOC_Os08g26700.3 downstream_gene_variant ; 2905.0bp to feature; MODIFIER silent_mutation Average:15.111; most accessible tissue: Callus, score: 32.265 N N N N
vg0816234557 A -> G LOC_Os08g26690-LOC_Os08g26700 intergenic_region ; MODIFIER silent_mutation Average:15.111; most accessible tissue: Callus, score: 32.265 N N N N
vg0816234557 A -> DEL N N silent_mutation Average:15.111; most accessible tissue: Callus, score: 32.265 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816234557 NA 1.68E-07 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816234557 NA 3.90E-16 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816234557 9.25E-06 NA mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816234557 4.33E-07 8.21E-06 mr1134_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251