\
| Variant ID: vg0816228377 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16228377 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TATAGGGACGTGGCAACTATAGAGTTCGATGAACTCGCCCTTGATGGGAGTAACTACCCAATTTGGGCTTCCGATATCAAAATATTTTTTTTTCTTCTTG[T/C]
GGGATTTAAAATACAATTGAGGAACCCAATGATTGGGATCCACCAGTTGAGAACAGAAAGCTATATATTGCCCTTTTCCTTCTGAGGCTCTACATCTATA
TATAGATGTAGAGCCTCAGAAGGAAAAGGGCAATATATAGCTTTCTGTTCTCAACTGGTGGATCCCAATCATTGGGTTCCTCAATTGTATTTTAAATCCC[A/G]
CAAGAAGAAAAAAAAATATTTTGATATCGGAAGCCCAAATTGGGTAGTTACTCCCATCAAGGGCGAGTTCATCGAACTCTATAGTTGCCACGTCCCTATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 4.60% | 17.90% | 19.72% | NA |
| All Indica | 2759 | 54.90% | 0.70% | 25.55% | 18.85% | NA |
| All Japonica | 1512 | 63.00% | 12.80% | 1.06% | 23.15% | NA |
| Aus | 269 | 43.10% | 0.00% | 42.38% | 14.50% | NA |
| Indica I | 595 | 67.40% | 1.20% | 19.66% | 11.76% | NA |
| Indica II | 465 | 56.80% | 0.20% | 23.44% | 19.57% | NA |
| Indica III | 913 | 46.20% | 0.80% | 30.34% | 22.67% | NA |
| Indica Intermediate | 786 | 54.60% | 0.40% | 25.70% | 19.34% | NA |
| Temperate Japonica | 767 | 97.30% | 1.40% | 0.26% | 1.04% | NA |
| Tropical Japonica | 504 | 21.60% | 18.50% | 1.98% | 57.94% | NA |
| Japonica Intermediate | 241 | 40.70% | 36.90% | 1.66% | 20.75% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 64.40% | 5.60% | 12.22% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816228377 | T -> C | LOC_Os08g26690.1 | upstream_gene_variant ; 447.0bp to feature; MODIFIER | silent_mutation | Average:9.07; most accessible tissue: Callus, score: 17.573 | N | N | N | N |
| vg0816228377 | T -> C | LOC_Os08g26685-LOC_Os08g26690 | intergenic_region ; MODIFIER | silent_mutation | Average:9.07; most accessible tissue: Callus, score: 17.573 | N | N | N | N |
| vg0816228377 | T -> DEL | N | N | silent_mutation | Average:9.07; most accessible tissue: Callus, score: 17.573 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816228377 | 4.76E-06 | NA | mr1519 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816228377 | NA | 4.20E-06 | mr1519 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816228377 | NA | 2.20E-06 | mr1064_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816228377 | NA | 2.29E-06 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816228377 | NA | 8.17E-07 | mr1519_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816228377 | 8.64E-07 | NA | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |