\
| Variant ID: vg0816220663 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16220663 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAACTCTCCACTTATTTTTCTAGTGTCCTTTTAGCACTCAATGCTGGGCGCAATTTGGTGTGGTTTGGAATCTTTCTTTGAGCTTTGGTGAAATGTTGGT[C/A]
ACGGCCAGAAATTCATAGAACTCTTCCTATTTTGTTGACAAGGTGCTTTATGCTGCTTGGAACATTTGGAAGCAGAGGAATAGTTTAATTTTCGAAAACA
TGTTTTCGAAAATTAAACTATTCCTCTGCTTCCAAATGTTCCAAGCAGCATAAAGCACCTTGTCAACAAAATAGGAAGAGTTCTATGAATTTCTGGCCGT[G/T]
ACCAACATTTCACCAAAGCTCAAAGAAAGATTCCAAACCACACCAAATTGCGCCCAGCATTGAGTGCTAAAAGGACACTAGAAAAATAAGTGGAGAGTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.90% | 39.90% | 3.11% | 8.06% | NA |
| All Indica | 2759 | 73.30% | 20.70% | 3.91% | 2.17% | NA |
| All Japonica | 1512 | 3.80% | 74.80% | 1.85% | 19.58% | NA |
| Aus | 269 | 76.20% | 16.00% | 2.60% | 5.20% | NA |
| Indica I | 595 | 51.30% | 44.70% | 3.53% | 0.50% | NA |
| Indica II | 465 | 71.60% | 21.50% | 3.87% | 3.01% | NA |
| Indica III | 913 | 91.10% | 2.70% | 3.83% | 2.30% | NA |
| Indica Intermediate | 786 | 70.10% | 22.80% | 4.33% | 2.80% | NA |
| Temperate Japonica | 767 | 0.30% | 98.60% | 0.13% | 1.04% | NA |
| Tropical Japonica | 504 | 8.90% | 37.70% | 4.56% | 48.81% | NA |
| Japonica Intermediate | 241 | 4.10% | 76.80% | 1.66% | 17.43% | NA |
| VI/Aromatic | 96 | 7.30% | 88.50% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 24.40% | 63.30% | 4.44% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816220663 | C -> A | LOC_Os08g26685.1 | intron_variant ; MODIFIER | silent_mutation | Average:9.197; most accessible tissue: Callus, score: 32.621 | N | N | N | N |
| vg0816220663 | C -> DEL | N | N | silent_mutation | Average:9.197; most accessible tissue: Callus, score: 32.621 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816220663 | 7.68E-06 | 1.28E-06 | mr1029 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816220663 | NA | 6.20E-06 | mr1047 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816220663 | 2.64E-06 | 2.67E-07 | mr1189 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816220663 | 3.76E-06 | 1.21E-06 | mr1471 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816220663 | 1.00E-06 | 1.19E-07 | mr1642 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816220663 | NA | 7.68E-11 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |