\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816201451:

Variant ID: vg0816201451 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16201451
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGGATCCTACGAGAAACTGTCCGGGAGTTAACATCCATAATGAGCGATGAATGGCTAAGGGAGGTAGAACTTTCATCCGAGGTAATTTGGATAAATACC[A/G]
CTCCCCGAGTCATTCCTTGCCATCTGGAAGGGAACGATGTCGGTATTCTCTACAGTCCAACTGTCGGGGCCAACCTCGTCTCCAAGTCTTTTGCATTCGC

Reverse complement sequence

GCGAATGCAAAAGACTTGGAGACGAGGTTGGCCCCGACAGTTGGACTGTAGAGAATACCGACATCGTTCCCTTCCAGATGGCAAGGAATGACTCGGGGAG[T/C]
GGTATTTATCCAAATTACCTCGGATGAAAGTTCTACCTCCCTTAGCCATTCATCGCTCATTATGGATGTTAACTCCCGGACAGTTTCTCGTAGGATCCCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.20% 1.20% 14.47% 48.12% NA
All Indica  2759 16.00% 1.50% 22.29% 60.20% NA
All Japonica  1512 72.80% 0.10% 1.52% 25.53% NA
Aus  269 10.40% 4.50% 12.27% 72.86% NA
Indica I  595 19.80% 0.20% 13.28% 66.72% NA
Indica II  465 14.00% 3.90% 26.45% 55.70% NA
Indica III  913 13.00% 0.80% 23.22% 62.98% NA
Indica Intermediate  786 17.70% 2.00% 25.57% 54.71% NA
Temperate Japonica  767 98.20% 0.00% 0.13% 1.69% NA
Tropical Japonica  504 33.50% 0.40% 3.57% 62.50% NA
Japonica Intermediate  241 74.30% 0.00% 1.66% 24.07% NA
VI/Aromatic  96 92.70% 0.00% 2.08% 5.21% NA
Intermediate  90 57.80% 1.10% 12.22% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816201451 A -> G LOC_Os08g26650.1 missense_variant ; p.Thr320Ala; MODERATE nonsynonymous_codon ; T320A Average:11.126; most accessible tissue: Callus, score: 35.504 possibly damaging -1.757 TOLERATED 0.85
vg0816201451 A -> DEL LOC_Os08g26650.1 N frameshift_variant Average:11.126; most accessible tissue: Callus, score: 35.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816201451 NA 2.70E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0816201451 NA 1.14E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0816201451 NA 6.38E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 1.07E-06 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 4.42E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 3.30E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 7.62E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 1.20E-07 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 3.04E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 1.05E-06 mr1092_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 4.96E-06 mr1152_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 2.31E-06 mr1194_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 2.89E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 3.28E-14 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 3.36E-23 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 2.15E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 1.34E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 3.07E-06 mr1604_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 2.11E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 6.00E-06 mr1813_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 9.66E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 4.14E-06 mr1854_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 3.48E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451 NA 2.00E-06 mr1894_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251