Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816201451:

Variant ID: vg0816201451 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16201451
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGGATCCTACGAGAAACTGTCCGGGAGTTAACATCCATAATGAGCGATGAATGGCTAAGGGAGGTAGAACTTTCATCCGAGGTAATTTGGATAAATACC[A/G]
CTCCCCGAGTCATTCCTTGCCATCTGGAAGGGAACGATGTCGGTATTCTCTACAGTCCAACTGTCGGGGCCAACCTCGTCTCCAAGTCTTTTGCATTCGC

Reverse complement sequence

GCGAATGCAAAAGACTTGGAGACGAGGTTGGCCCCGACAGTTGGACTGTAGAGAATACCGACATCGTTCCCTTCCAGATGGCAAGGAATGACTCGGGGAG[T/C]
GGTATTTATCCAAATTACCTCGGATGAAAGTTCTACCTCCCTTAGCCATTCATCGCTCATTATGGATGTTAACTCCCGGACAGTTTCTCGTAGGATCCCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.20%	1.20%	14.47%	48.12%	NA
All Indica	2759	16.00%	1.50%	22.29%	60.20%	NA
All Japonica	1512	72.80%	0.10%	1.52%	25.53%	NA
Aus	269	10.40%	4.50%	12.27%	72.86%	NA
Indica I	595	19.80%	0.20%	13.28%	66.72%	NA
Indica II	465	14.00%	3.90%	26.45%	55.70%	NA
Indica III	913	13.00%	0.80%	23.22%	62.98%	NA
Indica Intermediate	786	17.70%	2.00%	25.57%	54.71%	NA
Temperate Japonica	767	98.20%	0.00%	0.13%	1.69%	NA
Tropical Japonica	504	33.50%	0.40%	3.57%	62.50%	NA
Japonica Intermediate	241	74.30%	0.00%	1.66%	24.07%	NA
VI/Aromatic	96	92.70%	0.00%	2.08%	5.21%	NA
Intermediate	90	57.80%	1.10%	12.22%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816201451	A -> G	LOC_Os08g26650.1	missense_variant ; p.Thr320Ala; MODERATE	nonsynonymous_codon ; T320A	Average:11.126; most accessible tissue: Callus, score: 35.504	possibly damaging	-1.757	TOLERATED	0.85
vg0816201451	A -> DEL	LOC_Os08g26650.1	N	frameshift_variant	Average:11.126; most accessible tissue: Callus, score: 35.504	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816201451	NA	2.70E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0816201451	NA	1.14E-12	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0816201451	NA	6.38E-07	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	1.07E-06	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	4.42E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	3.30E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	7.62E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	1.20E-07	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	3.04E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	1.05E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	4.96E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	2.31E-06	mr1194_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	2.89E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	3.28E-14	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	3.36E-23	mr1304_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	2.15E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	1.34E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	3.07E-06	mr1604_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	2.11E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	6.00E-06	mr1813_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	9.66E-12	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	4.14E-06	mr1854_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	3.48E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816201451	NA	2.00E-06	mr1894_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251