Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816191471:

Variant ID: vg0816191471 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16191471
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTATTTTTTTTCCTTTCTTCTCGTTCCTCTCACTGAAATTGTAGGGCACCACAGGGTCCCAGAGAAAGGAGAAGAAAAGAAGAAAAAAGAGAAGGAGAAG[T/A]
AAAGAAGATAAACAAGGAAAATTTTTATGTGGGTCCAATTTTTTAGTCAAGATGATGCCACGTCACGTCCGTGTGGCATGCCACATTAGTGCCACGTAGG

Reverse complement sequence

CCTACGTGGCACTAATGTGGCATGCCACACGGACGTGACGTGGCATCATCTTGACTAAAAAATTGGACCCACATAAAAATTTTCCTTGTTTATCTTCTTT[A/T]
CTTCTCCTTCTCTTTTTTCTTCTTTTCTTCTCCTTTCTCTGGGACCCTGTGGTGCCCTACAATTTCAGTGAGAGGAACGAGAAGAAAGGAAAAAAAATAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.90%	18.20%	5.35%	50.53%	NA
All Indica	2759	8.00%	23.30%	8.45%	60.24%	NA
All Japonica	1512	56.60%	13.80%	0.40%	29.17%	NA
Aus	269	4.80%	0.70%	3.35%	91.08%	NA
Indica I	595	17.30%	32.80%	10.92%	38.99%	NA
Indica II	465	8.20%	9.90%	7.31%	74.62%	NA
Indica III	913	1.10%	25.00%	6.35%	67.58%	NA
Indica Intermediate	786	8.80%	22.30%	9.67%	59.29%	NA
Temperate Japonica	767	96.50%	1.40%	0.13%	1.96%	NA
Tropical Japonica	504	6.50%	20.00%	0.60%	72.82%	NA
Japonica Intermediate	241	34.40%	40.20%	0.83%	24.48%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	50.00%	7.80%	5.56%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816191471	T -> A	LOC_Os08g26610.1	upstream_gene_variant ; 4622.0bp to feature; MODIFIER	silent_mutation	Average:20.649; most accessible tissue: Callus, score: 53.438	N	N	N	N
vg0816191471	T -> A	LOC_Os08g26630.1	upstream_gene_variant ; 3325.0bp to feature; MODIFIER	silent_mutation	Average:20.649; most accessible tissue: Callus, score: 53.438	N	N	N	N
vg0816191471	T -> A	LOC_Os08g26620.1	intron_variant ; MODIFIER	silent_mutation	Average:20.649; most accessible tissue: Callus, score: 53.438	N	N	N	N
vg0816191471	T -> DEL	N	N	silent_mutation	Average:20.649; most accessible tissue: Callus, score: 53.438	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816191471	NA	1.20E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	4.72E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	1.47E-06	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	3.73E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	1.01E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	4.28E-08	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	6.34E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	2.20E-12	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	1.94E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	8.42E-11	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	4.09E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	6.96E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	4.57E-09	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	5.80E-10	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	1.71E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	7.65E-06	NA	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	9.26E-07	NA	mr1860_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471	NA	2.35E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251