\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816191471:

Variant ID: vg0816191471 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16191471
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATTTTTTTTCCTTTCTTCTCGTTCCTCTCACTGAAATTGTAGGGCACCACAGGGTCCCAGAGAAAGGAGAAGAAAAGAAGAAAAAAGAGAAGGAGAAG[T/A]
AAAGAAGATAAACAAGGAAAATTTTTATGTGGGTCCAATTTTTTAGTCAAGATGATGCCACGTCACGTCCGTGTGGCATGCCACATTAGTGCCACGTAGG

Reverse complement sequence

CCTACGTGGCACTAATGTGGCATGCCACACGGACGTGACGTGGCATCATCTTGACTAAAAAATTGGACCCACATAAAAATTTTCCTTGTTTATCTTCTTT[A/T]
CTTCTCCTTCTCTTTTTTCTTCTTTTCTTCTCCTTTCTCTGGGACCCTGTGGTGCCCTACAATTTCAGTGAGAGGAACGAGAAGAAAGGAAAAAAAATAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.90% 18.20% 5.35% 50.53% NA
All Indica  2759 8.00% 23.30% 8.45% 60.24% NA
All Japonica  1512 56.60% 13.80% 0.40% 29.17% NA
Aus  269 4.80% 0.70% 3.35% 91.08% NA
Indica I  595 17.30% 32.80% 10.92% 38.99% NA
Indica II  465 8.20% 9.90% 7.31% 74.62% NA
Indica III  913 1.10% 25.00% 6.35% 67.58% NA
Indica Intermediate  786 8.80% 22.30% 9.67% 59.29% NA
Temperate Japonica  767 96.50% 1.40% 0.13% 1.96% NA
Tropical Japonica  504 6.50% 20.00% 0.60% 72.82% NA
Japonica Intermediate  241 34.40% 40.20% 0.83% 24.48% NA
VI/Aromatic  96 92.70% 0.00% 0.00% 7.29% NA
Intermediate  90 50.00% 7.80% 5.56% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816191471 T -> A LOC_Os08g26610.1 upstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:20.649; most accessible tissue: Callus, score: 53.438 N N N N
vg0816191471 T -> A LOC_Os08g26630.1 upstream_gene_variant ; 3325.0bp to feature; MODIFIER silent_mutation Average:20.649; most accessible tissue: Callus, score: 53.438 N N N N
vg0816191471 T -> A LOC_Os08g26620.1 intron_variant ; MODIFIER silent_mutation Average:20.649; most accessible tissue: Callus, score: 53.438 N N N N
vg0816191471 T -> DEL N N silent_mutation Average:20.649; most accessible tissue: Callus, score: 53.438 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816191471 NA 1.20E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 4.72E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 1.47E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 3.73E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 1.01E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 4.28E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 6.34E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 2.20E-12 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 1.94E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 8.42E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 4.09E-06 mr1509_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 6.96E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 4.57E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 5.80E-10 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 1.71E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 7.65E-06 NA mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 9.26E-07 NA mr1860_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816191471 NA 2.35E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251