\
| Variant ID: vg0816117066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16117066 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 61. )
CGTGGTTTATCTAAACTTAAGAAAGATCTTGATTTGGTTTGTACACCGTGTCATCATGCTAAGATGGTTGCTTCTTCACATGCTCCTATTATTTCTGTGA[G/T]
GACGGATGCACCGGGACAGCTATTACACATGGACACTGTTGGTCCAGCTAGAGTGCAATCTGTTGGAGGAAAGTGGTATGTGTGGGTTATTGTTCACGAT
ATCGTGAACAATAACCCACACATACCACTTTCCTCCAACAGATTGCACTCTAGCTGGACCAACAGTGTCCATGTGTAATAGCTGTCCCGGTGCATCCGTC[C/A]
TCACAGAAATAATAGGAGCATGTGAAGAAGCAACCATCTTAGCATGATGACACGGTGTACAAACCAAATCAAGATCTTTCTTAAGTTTAGATAAACCACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.40% | 14.00% | 10.11% | 51.54% | NA |
| All Indica | 2759 | 5.80% | 3.00% | 15.91% | 75.28% | NA |
| All Japonica | 1512 | 56.50% | 33.00% | 1.12% | 9.39% | NA |
| Aus | 269 | 3.30% | 20.10% | 6.32% | 70.26% | NA |
| Indica I | 595 | 12.30% | 0.50% | 12.27% | 74.96% | NA |
| Indica II | 465 | 6.50% | 4.70% | 18.71% | 70.11% | NA |
| Indica III | 913 | 1.10% | 2.00% | 18.07% | 78.86% | NA |
| Indica Intermediate | 786 | 6.10% | 5.00% | 14.50% | 74.43% | NA |
| Temperate Japonica | 767 | 96.30% | 0.90% | 0.39% | 2.35% | NA |
| Tropical Japonica | 504 | 6.00% | 74.40% | 1.59% | 18.06% | NA |
| Japonica Intermediate | 241 | 35.30% | 48.50% | 2.49% | 13.69% | NA |
| VI/Aromatic | 96 | 92.70% | 4.20% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 43.30% | 23.30% | 4.44% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816117066 | G -> T | LOC_Os08g26450.1 | missense_variant ; p.Arg737Met; MODERATE | nonsynonymous_codon ; R737M | Average:8.232; most accessible tissue: Callus, score: 29.112 | possibly damaging |
-1.836 |
TOLERATED | 1.00 |
| vg0816117066 | G -> DEL | LOC_Os08g26450.1 | N | frameshift_variant | Average:8.232; most accessible tissue: Callus, score: 29.112 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816117066 | NA | 2.79E-09 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 5.60E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 8.99E-08 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 1.78E-08 | mr1189_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 1.41E-06 | mr1268_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 1.90E-07 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 8.79E-13 | mr1361_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 6.21E-06 | mr1397_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 1.30E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 1.31E-06 | mr1509_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 3.61E-10 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 2.10E-10 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 1.94E-07 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 5.13E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816117066 | NA | 1.58E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |