\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816111876:

Variant ID: vg0816111876 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16111876
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTTTATTTTCCTAAGGGTTATAATTTGATTAGCTAGAACCTTATATATTAGTTTGGTTCAGCTAAATGCTATATATATAATTGCTTAGCCATGCTTAG[G/A]
AACATTAGCTCACTAATAGGATGAATCATATATACTACATTATTATTTATGGTTATATTTAATGGTAGCTTACGATGGTTAATCATGTTATGATAATTAA

Reverse complement sequence

TTAATTATCATAACATGATTAACCATCGTAAGCTACCATTAAATATAACCATAAATAATAATGTAGTATATATGATTCATCCTATTAGTGAGCTAATGTT[C/T]
CTAAGCATGGCTAAGCAATTATATATATAGCATTTAGCTGAACCAAACTAATATATAAGGTTCTAGCTAATCAAATTATAACCCTTAGGAAAATAAAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.20% 1.10% 45.87% 26.83% NA
All Indica  2759 8.80% 0.10% 65.17% 25.95% NA
All Japonica  1512 55.60% 3.10% 10.45% 30.89% NA
Aus  269 8.90% 0.00% 67.66% 23.42% NA
Indica I  595 20.80% 0.00% 45.04% 34.12% NA
Indica II  465 8.20% 0.00% 55.91% 35.91% NA
Indica III  913 2.00% 0.00% 86.20% 11.83% NA
Indica Intermediate  786 7.90% 0.40% 61.45% 30.28% NA
Temperate Japonica  767 90.10% 6.10% 0.78% 3.00% NA
Tropical Japonica  504 10.70% 0.00% 26.79% 62.50% NA
Japonica Intermediate  241 39.40% 0.00% 7.05% 53.53% NA
VI/Aromatic  96 92.70% 0.00% 5.21% 2.08% NA
Intermediate  90 50.00% 0.00% 27.78% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816111876 G -> A LOC_Os08g26440.1 upstream_gene_variant ; 556.0bp to feature; MODIFIER silent_mutation Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0816111876 G -> A LOC_Os08g26450.1 upstream_gene_variant ; 2201.0bp to feature; MODIFIER silent_mutation Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0816111876 G -> A LOC_Os08g26430.1 downstream_gene_variant ; 3292.0bp to feature; MODIFIER silent_mutation Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0816111876 G -> A LOC_Os08g26440-LOC_Os08g26450 intergenic_region ; MODIFIER silent_mutation Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0816111876 G -> DEL N N silent_mutation Average:7.278; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816111876 1.09E-06 NA mr1335_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251