\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816086900:

Variant ID: vg0816086900 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16086900
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGATTATACAGGGGTAAATATAAAGTATTAGTTCAAGTGATCTCTATTATGAATCTTCCCCAACAACGGTGCCAGAAATGCTTGTTGGTATTTCTTAA[T/C]
GACATTACTAGAAATATAATTCCCAGCAATGGCGCAGAAATACTTCTAGTATATTATGGTTACAGAGTTCATCCGCAAGCGCACGGATATACTATTGTAG

Reverse complement sequence

CTACAATAGTATATCCGTGCGCTTGCGGATGAACTCTGTAACCATAATATACTAGAAGTATTTCTGCGCCATTGCTGGGAATTATATTTCTAGTAATGTC[A/G]
TTAAGAAATACCAACAAGCATTTCTGGCACCGTTGTTGGGGAAGATTCATAATAGAGATCACTTGAACTAATACTTTATATTTACCCCTGTATAATCATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 0.60% 15.62% 2.75% NA
All Indica  2759 89.30% 0.90% 9.31% 0.43% NA
All Japonica  1512 65.20% 0.20% 27.71% 6.88% NA
Aus  269 77.70% 0.00% 18.59% 3.72% NA
Indica I  595 74.50% 0.50% 23.87% 1.18% NA
Indica II  465 96.10% 0.60% 3.01% 0.22% NA
Indica III  913 95.30% 1.20% 3.29% 0.22% NA
Indica Intermediate  786 89.70% 1.00% 9.03% 0.25% NA
Temperate Japonica  767 97.80% 0.00% 1.43% 0.78% NA
Tropical Japonica  504 24.40% 0.60% 66.87% 8.13% NA
Japonica Intermediate  241 46.90% 0.00% 29.46% 23.65% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 1.10% 13.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816086900 T -> C LOC_Os08g26390.1 upstream_gene_variant ; 3189.0bp to feature; MODIFIER silent_mutation Average:11.107; most accessible tissue: Callus, score: 19.951 N N N N
vg0816086900 T -> C LOC_Os08g26400.1 upstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:11.107; most accessible tissue: Callus, score: 19.951 N N N N
vg0816086900 T -> C LOC_Os08g26400-LOC_Os08g26409 intergenic_region ; MODIFIER silent_mutation Average:11.107; most accessible tissue: Callus, score: 19.951 N N N N
vg0816086900 T -> DEL N N silent_mutation Average:11.107; most accessible tissue: Callus, score: 19.951 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816086900 NA 6.71E-08 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 2.40E-07 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 1.31E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 2.38E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 1.11E-06 1.11E-06 mr1335_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 3.84E-06 3.84E-06 mr1418_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 6.30E-06 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 1.25E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 3.90E-06 8.54E-07 mr1488_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 6.35E-07 6.35E-07 mr1506_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 2.04E-06 3.21E-06 mr1591_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 1.59E-06 8.12E-06 mr1594_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 2.70E-06 2.19E-07 mr1646_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 3.74E-06 mr1689_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 2.06E-06 mr1739_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 7.66E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 6.11E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 3.75E-06 mr1779_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 5.80E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 9.62E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 1.32E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816086900 NA 2.13E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251