\
| Variant ID: vg0816083361 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16083361 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TACAGGAATTGTGAAAGCCAAGAAGTGTACTTAAGCCTTTCCATGTAAGTGTATACTCCTTATGGAAAAAGCGAAAGGAAATTCCATCTTCTATTTCTTT[T/C,A]
AAAGTGCACAGAAATTGCAAAGTAAGCAAACGAGAACCAGGCTCATCTACCACAGCAAATCTCTGCCAACCAACAGCTTTCCAAATAGCACAAAATTCAA
TTGAATTTTGTGCTATTTGGAAAGCTGTTGGTTGGCAGAGATTTGCTGTGGTAGATGAGCCTGGTTCTCGTTTGCTTACTTTGCAATTTCTGTGCACTTT[A/G,T]
AAAGAAATAGAAGATGGAATTTCCTTTCGCTTTTTCCATAAGGAGTATACACTTACATGGAAAGGCTTAAGTACACTTCTTGGCTTTCACAATTCCTGTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.10% | 1.10% | 20.29% | 52.43% | A: 0.06% |
| All Indica | 2759 | 7.80% | 1.30% | 22.29% | 68.65% | NA |
| All Japonica | 1512 | 58.00% | 1.10% | 10.78% | 30.09% | NA |
| Aus | 269 | 4.50% | 0.00% | 61.34% | 33.09% | A: 1.12% |
| Indica I | 595 | 15.10% | 0.20% | 17.48% | 67.23% | NA |
| Indica II | 465 | 4.30% | 0.90% | 24.73% | 70.11% | NA |
| Indica III | 913 | 4.80% | 2.20% | 22.56% | 70.43% | NA |
| Indica Intermediate | 786 | 7.60% | 1.40% | 24.17% | 66.79% | NA |
| Temperate Japonica | 767 | 96.30% | 0.00% | 0.39% | 3.26% | NA |
| Tropical Japonica | 504 | 9.90% | 3.20% | 28.37% | 58.53% | NA |
| Japonica Intermediate | 241 | 36.50% | 0.40% | 7.05% | 56.02% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 5.21% | 2.08% | NA |
| Intermediate | 90 | 44.40% | 1.10% | 12.22% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816083361 | T -> C | LOC_Os08g26380.1 | downstream_gene_variant ; 4149.0bp to feature; MODIFIER | silent_mutation | Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0816083361 | T -> C | LOC_Os08g26400.1 | downstream_gene_variant ; 944.0bp to feature; MODIFIER | silent_mutation | Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0816083361 | T -> C | LOC_Os08g26390.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0816083361 | T -> A | LOC_Os08g26380.1 | downstream_gene_variant ; 4149.0bp to feature; MODIFIER | silent_mutation | Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0816083361 | T -> A | LOC_Os08g26400.1 | downstream_gene_variant ; 944.0bp to feature; MODIFIER | silent_mutation | Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0816083361 | T -> A | LOC_Os08g26390.1 | intron_variant ; MODIFIER | silent_mutation | Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0816083361 | T -> DEL | N | N | silent_mutation | Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816083361 | NA | 4.25E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816083361 | NA | 5.45E-11 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816083361 | 4.77E-06 | NA | mr1538_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816083361 | NA | 1.03E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816083361 | NA | 1.65E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816083361 | NA | 4.13E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816083361 | NA | 6.77E-08 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816083361 | NA | 5.68E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816083361 | NA | 8.62E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816083361 | 1.03E-06 | NA | mr1976_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |