\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816083361:

Variant ID: vg0816083361 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16083361
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACAGGAATTGTGAAAGCCAAGAAGTGTACTTAAGCCTTTCCATGTAAGTGTATACTCCTTATGGAAAAAGCGAAAGGAAATTCCATCTTCTATTTCTTT[T/C,A]
AAAGTGCACAGAAATTGCAAAGTAAGCAAACGAGAACCAGGCTCATCTACCACAGCAAATCTCTGCCAACCAACAGCTTTCCAAATAGCACAAAATTCAA

Reverse complement sequence

TTGAATTTTGTGCTATTTGGAAAGCTGTTGGTTGGCAGAGATTTGCTGTGGTAGATGAGCCTGGTTCTCGTTTGCTTACTTTGCAATTTCTGTGCACTTT[A/G,T]
AAAGAAATAGAAGATGGAATTTCCTTTCGCTTTTTCCATAAGGAGTATACACTTACATGGAAAGGCTTAAGTACACTTCTTGGCTTTCACAATTCCTGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.10% 1.10% 20.29% 52.43% A: 0.06%
All Indica  2759 7.80% 1.30% 22.29% 68.65% NA
All Japonica  1512 58.00% 1.10% 10.78% 30.09% NA
Aus  269 4.50% 0.00% 61.34% 33.09% A: 1.12%
Indica I  595 15.10% 0.20% 17.48% 67.23% NA
Indica II  465 4.30% 0.90% 24.73% 70.11% NA
Indica III  913 4.80% 2.20% 22.56% 70.43% NA
Indica Intermediate  786 7.60% 1.40% 24.17% 66.79% NA
Temperate Japonica  767 96.30% 0.00% 0.39% 3.26% NA
Tropical Japonica  504 9.90% 3.20% 28.37% 58.53% NA
Japonica Intermediate  241 36.50% 0.40% 7.05% 56.02% NA
VI/Aromatic  96 92.70% 0.00% 5.21% 2.08% NA
Intermediate  90 44.40% 1.10% 12.22% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816083361 T -> C LOC_Os08g26380.1 downstream_gene_variant ; 4149.0bp to feature; MODIFIER silent_mutation Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0816083361 T -> C LOC_Os08g26400.1 downstream_gene_variant ; 944.0bp to feature; MODIFIER silent_mutation Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0816083361 T -> C LOC_Os08g26390.1 intron_variant ; MODIFIER silent_mutation Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0816083361 T -> A LOC_Os08g26380.1 downstream_gene_variant ; 4149.0bp to feature; MODIFIER silent_mutation Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0816083361 T -> A LOC_Os08g26400.1 downstream_gene_variant ; 944.0bp to feature; MODIFIER silent_mutation Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0816083361 T -> A LOC_Os08g26390.1 intron_variant ; MODIFIER silent_mutation Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0816083361 T -> DEL N N silent_mutation Average:12.171; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816083361 NA 4.25E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816083361 NA 5.45E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816083361 4.77E-06 NA mr1538_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816083361 NA 1.03E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816083361 NA 1.65E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816083361 NA 4.13E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816083361 NA 6.77E-08 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816083361 NA 5.68E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816083361 NA 8.62E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816083361 1.03E-06 NA mr1976_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251