Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816078722:

Variant ID: vg0816078722 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16078722
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, C: 0.30, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGACGGCGCCAATAAGCTATGTTTTTAGTGCCAGTTTAGGAACTGGCTCCTATAACACCTACGATGAGAAAAAAACGATTTGTCTTGATGAATCGAGT[G/C]
AATGCACCTCCTAAGATCCACATCAAAGTCATACATGGAGAAGCCACAGAAGAAAAAAAAATCAACAATATCACATTTCACTCAAAAACAAATCAAGAAC

Reverse complement sequence

GTTCTTGATTTGTTTTTGAGTGAAATGTGATATTGTTGATTTTTTTTTCTTCTGTGGCTTCTCCATGTATGACTTTGATGTGGATCTTAGGAGGTGCATT[C/G]
ACTCGATTCATCAAGACAAATCGTTTTTTTCTCATCGTAGGTGTTATAGGAGCCAGTTCCTAAACTGGCACTAAAAACATAGCTTATTGGCGCCGTCTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	23.50%	2.10%	0.25%	74.16%	NA
All Indica	2759	4.40%	0.60%	0.40%	94.60%	NA
All Japonica	1512	56.50%	5.30%	0.00%	38.23%	NA
Aus	269	3.00%	0.00%	0.37%	96.65%	NA
Indica I	595	10.30%	0.00%	0.84%	88.91%	NA
Indica II	465	2.40%	2.80%	0.43%	94.41%	NA
Indica III	913	0.90%	0.00%	0.11%	99.01%	NA
Indica Intermediate	786	5.30%	0.40%	0.38%	93.89%	NA
Temperate Japonica	767	96.30%	0.70%	0.00%	3.00%	NA
Tropical Japonica	504	6.00%	2.00%	0.00%	92.06%	NA
Japonica Intermediate	241	35.30%	27.00%	0.00%	37.76%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	43.30%	1.10%	0.00%	55.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816078722	G -> C	LOC_Os08g26380.1	upstream_gene_variant ; 35.0bp to feature; MODIFIER	silent_mutation	Average:12.414; most accessible tissue: Callus, score: 76.63	N	N	N	N
vg0816078722	G -> C	LOC_Os08g26390.1	downstream_gene_variant ; 3623.0bp to feature; MODIFIER	silent_mutation	Average:12.414; most accessible tissue: Callus, score: 76.63	N	N	N	N
vg0816078722	G -> C	LOC_Os08g26370-LOC_Os08g26380	intergenic_region ; MODIFIER	silent_mutation	Average:12.414; most accessible tissue: Callus, score: 76.63	N	N	N	N
vg0816078722	G -> DEL	N	N	silent_mutation	Average:12.414; most accessible tissue: Callus, score: 76.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816078722	4.53E-06	NA	mr1079_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816078722	5.79E-06	NA	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816078722	NA	5.67E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251