\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816073881:

Variant ID: vg0816073881 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16073881
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCAGCGCTCCTCGACTTGGTCTGCAAATGGGCCAAACCAGCGAGCTTCTGGGCCTAAACGACAGATAGGATAGGCTGGAAACGAGACTGCCGTCGGATG[T/C]
GGAATGCACGGTGATCCAGCGGGGACGTCCCTCTGACGTAAAAATCCTCTACGTCAGAGGATCCGCTTCTCCTGCTCCACAGTACTGATGGGCTTATGGG

Reverse complement sequence

CCCATAAGCCCATCAGTACTGTGGAGCAGGAGAAGCGGATCCTCTGACGTAGAGGATTTTTACGTCAGAGGGACGTCCCCGCTGGATCACCGTGCATTCC[A/G]
CATCCGACGGCAGTCTCGTTTCCAGCCTATCCTATCTGTCGTTTAGGCCCAGAAGCTCGCTGGTTTGGCCCATTTGCAGACCAAGTCGAGGAGCGCTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.60% 29.60% 2.54% 25.24% NA
All Indica  2759 69.70% 6.20% 3.55% 20.55% NA
All Japonica  1512 1.90% 69.50% 0.53% 28.11% NA
Aus  269 12.30% 36.40% 2.60% 48.70% NA
Indica I  595 88.40% 5.40% 2.86% 3.36% NA
Indica II  465 54.40% 6.00% 5.16% 34.41% NA
Indica III  913 65.90% 6.90% 2.85% 24.32% NA
Indica Intermediate  786 68.80% 6.20% 3.94% 20.99% NA
Temperate Japonica  767 0.50% 97.80% 0.13% 1.56% NA
Tropical Japonica  504 2.60% 25.40% 1.19% 70.83% NA
Japonica Intermediate  241 4.60% 71.80% 0.41% 23.24% NA
VI/Aromatic  96 6.20% 40.60% 3.12% 50.00% NA
Intermediate  90 28.90% 42.20% 4.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816073881 T -> C LOC_Os08g26360.1 upstream_gene_variant ; 2399.0bp to feature; MODIFIER silent_mutation Average:95.021; most accessible tissue: Minghui63 young leaf, score: 98.816 N N N N
vg0816073881 T -> C LOC_Os08g26380.1 upstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:95.021; most accessible tissue: Minghui63 young leaf, score: 98.816 N N N N
vg0816073881 T -> C LOC_Os08g26370.1 downstream_gene_variant ; 179.0bp to feature; MODIFIER silent_mutation Average:95.021; most accessible tissue: Minghui63 young leaf, score: 98.816 N N N N
vg0816073881 T -> C LOC_Os08g26370-LOC_Os08g26380 intergenic_region ; MODIFIER silent_mutation Average:95.021; most accessible tissue: Minghui63 young leaf, score: 98.816 N N N N
vg0816073881 T -> DEL N N silent_mutation Average:95.021; most accessible tissue: Minghui63 young leaf, score: 98.816 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0816073881 T C -0.03 -0.05 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816073881 NA 3.09E-08 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 NA 4.47E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 5.61E-06 5.61E-06 mr1259 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 NA 2.51E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 5.47E-06 NA mr1820 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 NA 2.73E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 1.60E-06 1.60E-06 mr1836 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 NA 2.29E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 NA 1.37E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 NA 1.83E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816073881 NA 1.98E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251