\
| Variant ID: vg0816069844 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16069844 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATACTTTAACCCTTAATTTATTCTAGGTTATATTTCTAAATATGAAATTATTATCACATTAAAGTTACACAAAAAGTTACTATTATAAATTTGATTATTA[A/G]
TCAAAAGTTATCGAGTTTGTTTCTCCTTAAAATAAGGATGCACTATAATTTGAGACCGAGGGAGTAATATTTAACTAAGTATACGCTAATCACTCGCTTT
AAAGCGAGTGATTAGCGTATACTTAGTTAAATATTACTCCCTCGGTCTCAAATTATAGTGCATCCTTATTTTAAGGAGAAACAAACTCGATAACTTTTGA[T/C]
TAATAATCAAATTTATAATAGTAACTTTTTGTGTAACTTTAATGTGATAATAATTTCATATTTAGAAATATAACCTAGAATAAATTAAGGGTTAAAGTAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.60% | 27.00% | 9.80% | 33.62% | NA |
| All Indica | 2759 | 38.60% | 3.00% | 11.38% | 47.05% | NA |
| All Japonica | 1512 | 13.40% | 69.90% | 3.97% | 12.70% | NA |
| Aus | 269 | 38.70% | 1.50% | 29.74% | 30.11% | NA |
| Indica I | 595 | 22.90% | 5.00% | 6.72% | 65.38% | NA |
| Indica II | 465 | 34.60% | 2.60% | 12.26% | 50.54% | NA |
| Indica III | 913 | 53.60% | 1.60% | 12.05% | 32.75% | NA |
| Indica Intermediate | 786 | 35.40% | 3.30% | 13.61% | 47.71% | NA |
| Temperate Japonica | 767 | 1.20% | 97.80% | 0.13% | 0.91% | NA |
| Tropical Japonica | 504 | 29.00% | 26.20% | 11.11% | 33.73% | NA |
| Japonica Intermediate | 241 | 19.90% | 72.60% | 1.24% | 6.22% | NA |
| VI/Aromatic | 96 | 5.20% | 92.70% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 26.70% | 45.60% | 8.89% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816069844 | A -> G | LOC_Os08g26350.1 | upstream_gene_variant ; 4137.0bp to feature; MODIFIER | silent_mutation | Average:13.576; most accessible tissue: Callus, score: 31.959 | N | N | N | N |
| vg0816069844 | A -> G | LOC_Os08g26370.1 | upstream_gene_variant ; 3198.0bp to feature; MODIFIER | silent_mutation | Average:13.576; most accessible tissue: Callus, score: 31.959 | N | N | N | N |
| vg0816069844 | A -> G | LOC_Os08g26360.1 | downstream_gene_variant ; 449.0bp to feature; MODIFIER | silent_mutation | Average:13.576; most accessible tissue: Callus, score: 31.959 | N | N | N | N |
| vg0816069844 | A -> G | LOC_Os08g26350-LOC_Os08g26360 | intergenic_region ; MODIFIER | silent_mutation | Average:13.576; most accessible tissue: Callus, score: 31.959 | N | N | N | N |
| vg0816069844 | A -> DEL | N | N | silent_mutation | Average:13.576; most accessible tissue: Callus, score: 31.959 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816069844 | NA | 5.67E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 1.31E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 3.69E-21 | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 1.35E-19 | mr1845 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 8.24E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 1.24E-12 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 1.97E-24 | mr1304_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 3.08E-08 | mr1304_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 5.47E-07 | mr1308_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | 1.15E-06 | NA | mr1335_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 3.42E-09 | mr1361_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 2.02E-07 | mr1401_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816069844 | NA | 6.36E-07 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |