\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816069844:

Variant ID: vg0816069844 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16069844
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACTTTAACCCTTAATTTATTCTAGGTTATATTTCTAAATATGAAATTATTATCACATTAAAGTTACACAAAAAGTTACTATTATAAATTTGATTATTA[A/G]
TCAAAAGTTATCGAGTTTGTTTCTCCTTAAAATAAGGATGCACTATAATTTGAGACCGAGGGAGTAATATTTAACTAAGTATACGCTAATCACTCGCTTT

Reverse complement sequence

AAAGCGAGTGATTAGCGTATACTTAGTTAAATATTACTCCCTCGGTCTCAAATTATAGTGCATCCTTATTTTAAGGAGAAACAAACTCGATAACTTTTGA[T/C]
TAATAATCAAATTTATAATAGTAACTTTTTGTGTAACTTTAATGTGATAATAATTTCATATTTAGAAATATAACCTAGAATAAATTAAGGGTTAAAGTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.60% 27.00% 9.80% 33.62% NA
All Indica  2759 38.60% 3.00% 11.38% 47.05% NA
All Japonica  1512 13.40% 69.90% 3.97% 12.70% NA
Aus  269 38.70% 1.50% 29.74% 30.11% NA
Indica I  595 22.90% 5.00% 6.72% 65.38% NA
Indica II  465 34.60% 2.60% 12.26% 50.54% NA
Indica III  913 53.60% 1.60% 12.05% 32.75% NA
Indica Intermediate  786 35.40% 3.30% 13.61% 47.71% NA
Temperate Japonica  767 1.20% 97.80% 0.13% 0.91% NA
Tropical Japonica  504 29.00% 26.20% 11.11% 33.73% NA
Japonica Intermediate  241 19.90% 72.60% 1.24% 6.22% NA
VI/Aromatic  96 5.20% 92.70% 1.04% 1.04% NA
Intermediate  90 26.70% 45.60% 8.89% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816069844 A -> G LOC_Os08g26350.1 upstream_gene_variant ; 4137.0bp to feature; MODIFIER silent_mutation Average:13.576; most accessible tissue: Callus, score: 31.959 N N N N
vg0816069844 A -> G LOC_Os08g26370.1 upstream_gene_variant ; 3198.0bp to feature; MODIFIER silent_mutation Average:13.576; most accessible tissue: Callus, score: 31.959 N N N N
vg0816069844 A -> G LOC_Os08g26360.1 downstream_gene_variant ; 449.0bp to feature; MODIFIER silent_mutation Average:13.576; most accessible tissue: Callus, score: 31.959 N N N N
vg0816069844 A -> G LOC_Os08g26350-LOC_Os08g26360 intergenic_region ; MODIFIER silent_mutation Average:13.576; most accessible tissue: Callus, score: 31.959 N N N N
vg0816069844 A -> DEL N N silent_mutation Average:13.576; most accessible tissue: Callus, score: 31.959 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816069844 NA 5.67E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 1.31E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 3.69E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 1.35E-19 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 8.24E-13 mr1853 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 1.24E-12 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 1.97E-24 mr1304_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 3.08E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 5.47E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 1.15E-06 NA mr1335_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 3.42E-09 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 2.02E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816069844 NA 6.36E-07 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251