Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816065682:

Variant ID: vg0816065682 (JBrowse)	Variation Type: INDEL
Chromosome: chr08	Position: 16065682
Reference Allele: C	Alternative Allele: T,CT
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAATGAGAACAGTACAATATTATTTGGACCATGAGTTGGAGTAATAGTACTCACCTGATCCGTACGACGACATCTTGATCTTGTCAGGCCTGTGAAATC[C/T,CT]
CTTGCTTCTGATCGATGCTTAGAGGATGTTATTGTTGGAGAAGAATTAACGTATTGGATCAGTTTATATAGTGCTCTCCATTTCAAAGACAATCAAAATT

Reverse complement sequence

AATTTTGATTGTCTTTGAAATGGAGAGCACTATATAAACTGATCCAATACGTTAATTCTTCTCCAACAATAACATCCTCTAAGCATCGATCAGAAGCAAG[G/A,AG]
GATTTCACAGGCCTGACAAGATCAAGATGTCGTCGTACGGATCAGGTGAGTACTATTACTCCAACTCATGGTCCAAATAATATTGTACTGTTCTCATTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	15.80%	1.21%	0.40%	CT: 0.02%
All Indica	2759	98.40%	1.10%	0.47%	0.00%	NA
All Japonica	1512	56.70%	41.90%	1.39%	0.00%	NA
Aus	269	98.10%	1.50%	0.00%	0.00%	CT: 0.37%
Indica I	595	97.10%	1.80%	1.01%	0.00%	NA
Indica II	465	98.90%	0.60%	0.43%	0.00%	NA
Indica III	913	99.50%	0.40%	0.11%	0.00%	NA
Indica Intermediate	786	98.00%	1.50%	0.51%	0.00%	NA
Temperate Japonica	767	25.60%	72.40%	2.09%	0.00%	NA
Tropical Japonica	504	98.80%	1.00%	0.20%	0.00%	NA
Japonica Intermediate	241	67.60%	30.70%	1.66%	0.00%	NA
VI/Aromatic	96	7.30%	51.00%	21.88%	19.79%	NA
Intermediate	90	66.70%	31.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816065682	C -> CT	LOC_Os08g26350.1	5_prime_UTR_variant ; 28.0bp to feature; MODIFIER	silent_mutation	Average:17.145; most accessible tissue: Callus, score: 40.377	N	N	N	N
vg0816065682	C -> CT	LOC_Os08g26340.1	downstream_gene_variant ; 3242.0bp to feature; MODIFIER	silent_mutation	Average:17.145; most accessible tissue: Callus, score: 40.377	N	N	N	N
vg0816065682	C -> CT	LOC_Os08g26360.1	downstream_gene_variant ; 4610.0bp to feature; MODIFIER	silent_mutation	Average:17.145; most accessible tissue: Callus, score: 40.377	N	N	N	N
vg0816065682	C -> T	LOC_Os08g26350.1	5_prime_UTR_variant ; 27.0bp to feature; MODIFIER	silent_mutation	Average:17.145; most accessible tissue: Callus, score: 40.377	N	N	N	N
vg0816065682	C -> T	LOC_Os08g26340.1	downstream_gene_variant ; 3241.0bp to feature; MODIFIER	silent_mutation	Average:17.145; most accessible tissue: Callus, score: 40.377	N	N	N	N
vg0816065682	C -> T	LOC_Os08g26360.1	downstream_gene_variant ; 4611.0bp to feature; MODIFIER	silent_mutation	Average:17.145; most accessible tissue: Callus, score: 40.377	N	N	N	N
vg0816065682	C -> DEL	N	N	silent_mutation	Average:17.145; most accessible tissue: Callus, score: 40.377	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816065682	NA	1.40E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	8.63E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	2.81E-06	NA	mr1037	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	8.43E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	7.55E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	6.61E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	3.18E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	2.28E-06	mr1492	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	6.43E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	7.03E-06	7.03E-06	mr1802	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	1.85E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	2.72E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	4.28E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	9.81E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	4.56E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	2.54E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	4.08E-18	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682	NA	7.14E-10	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251