\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816065682:

Variant ID: vg0816065682 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 16065682
Reference Allele: CAlternative Allele: T,CT
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAATGAGAACAGTACAATATTATTTGGACCATGAGTTGGAGTAATAGTACTCACCTGATCCGTACGACGACATCTTGATCTTGTCAGGCCTGTGAAATC[C/T,CT]
CTTGCTTCTGATCGATGCTTAGAGGATGTTATTGTTGGAGAAGAATTAACGTATTGGATCAGTTTATATAGTGCTCTCCATTTCAAAGACAATCAAAATT

Reverse complement sequence

AATTTTGATTGTCTTTGAAATGGAGAGCACTATATAAACTGATCCAATACGTTAATTCTTCTCCAACAATAACATCCTCTAAGCATCGATCAGAAGCAAG[G/A,AG]
GATTTCACAGGCCTGACAAGATCAAGATGTCGTCGTACGGATCAGGTGAGTACTATTACTCCAACTCATGGTCCAAATAATATTGTACTGTTCTCATTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 15.80% 1.21% 0.40% CT: 0.02%
All Indica  2759 98.40% 1.10% 0.47% 0.00% NA
All Japonica  1512 56.70% 41.90% 1.39% 0.00% NA
Aus  269 98.10% 1.50% 0.00% 0.00% CT: 0.37%
Indica I  595 97.10% 1.80% 1.01% 0.00% NA
Indica II  465 98.90% 0.60% 0.43% 0.00% NA
Indica III  913 99.50% 0.40% 0.11% 0.00% NA
Indica Intermediate  786 98.00% 1.50% 0.51% 0.00% NA
Temperate Japonica  767 25.60% 72.40% 2.09% 0.00% NA
Tropical Japonica  504 98.80% 1.00% 0.20% 0.00% NA
Japonica Intermediate  241 67.60% 30.70% 1.66% 0.00% NA
VI/Aromatic  96 7.30% 51.00% 21.88% 19.79% NA
Intermediate  90 66.70% 31.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816065682 C -> CT LOC_Os08g26350.1 5_prime_UTR_variant ; 28.0bp to feature; MODIFIER silent_mutation Average:17.145; most accessible tissue: Callus, score: 40.377 N N N N
vg0816065682 C -> CT LOC_Os08g26340.1 downstream_gene_variant ; 3242.0bp to feature; MODIFIER silent_mutation Average:17.145; most accessible tissue: Callus, score: 40.377 N N N N
vg0816065682 C -> CT LOC_Os08g26360.1 downstream_gene_variant ; 4610.0bp to feature; MODIFIER silent_mutation Average:17.145; most accessible tissue: Callus, score: 40.377 N N N N
vg0816065682 C -> T LOC_Os08g26350.1 5_prime_UTR_variant ; 27.0bp to feature; MODIFIER silent_mutation Average:17.145; most accessible tissue: Callus, score: 40.377 N N N N
vg0816065682 C -> T LOC_Os08g26340.1 downstream_gene_variant ; 3241.0bp to feature; MODIFIER silent_mutation Average:17.145; most accessible tissue: Callus, score: 40.377 N N N N
vg0816065682 C -> T LOC_Os08g26360.1 downstream_gene_variant ; 4611.0bp to feature; MODIFIER silent_mutation Average:17.145; most accessible tissue: Callus, score: 40.377 N N N N
vg0816065682 C -> DEL N N silent_mutation Average:17.145; most accessible tissue: Callus, score: 40.377 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816065682 NA 1.40E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 8.63E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 2.81E-06 NA mr1037 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 8.43E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 7.55E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 6.61E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 3.18E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 2.28E-06 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 6.43E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 7.03E-06 7.03E-06 mr1802 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 1.85E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 2.72E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 4.28E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 9.81E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 4.56E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 2.54E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 4.08E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816065682 NA 7.14E-10 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251