\
| Variant ID: vg0816052546 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16052546 |
| Reference Allele: A | Alternative Allele: C,G |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )
ATCTCCACATCATTTTCACATTATTTAAACATATACATCTATCATTTCTATAAGTATAACTTGCATTTATCCGTACATCCCGCAGCAAATCTTGGGATAT[A/C,G]
AACTAGTTAATTAGATAGAGATATCCTACCTTATACCCTCCCATCTTTCTATCCCCATCTACCTAAAGCTGTCTTTATTCTATACATGTATGGTTATTTT
AAAATAACCATACATGTATAGAATAAAGACAGCTTTAGGTAGATGGGGATAGAAAGATGGGAGGGTATAAGGTAGGATATCTCTATCTAATTAACTAGTT[T/G,C]
ATATCCCAAGATTTGCTGCGGGATGTACGGATAAATGCAAGTTATACTTATAGAAATGATAGATGTATATGTTTAAATAATGTGAAAATGATGTGGAGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.80% | 15.80% | 0.13% | 0.21% | NA |
| All Indica | 2759 | 99.20% | 0.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 58.40% | 41.40% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 28.20% | 71.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.40% | 28.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 82.30% | 2.08% | 8.33% | NA |
| Intermediate | 90 | 72.20% | 25.60% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816052546 | A -> G | LOC_Os08g26320.1 | upstream_gene_variant ; 1390.0bp to feature; MODIFIER | N | Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0816052546 | A -> G | LOC_Os08g26330.1 | upstream_gene_variant ; 501.0bp to feature; MODIFIER | N | Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0816052546 | A -> G | LOC_Os08g26310.1 | downstream_gene_variant ; 3032.0bp to feature; MODIFIER | N | Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0816052546 | A -> G | LOC_Os08g26320-LOC_Os08g26330 | intergenic_region ; MODIFIER | N | Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0816052546 | A -> C | LOC_Os08g26320.1 | upstream_gene_variant ; 1390.0bp to feature; MODIFIER | silent_mutation | Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0816052546 | A -> C | LOC_Os08g26330.1 | upstream_gene_variant ; 501.0bp to feature; MODIFIER | silent_mutation | Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0816052546 | A -> C | LOC_Os08g26310.1 | downstream_gene_variant ; 3032.0bp to feature; MODIFIER | silent_mutation | Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0816052546 | A -> C | LOC_Os08g26320-LOC_Os08g26330 | intergenic_region ; MODIFIER | silent_mutation | Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| vg0816052546 | A -> DEL | N | N | silent_mutation | Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816052546 | NA | 6.94E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 3.30E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 1.92E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 4.99E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 4.47E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | 8.30E-06 | 8.29E-06 | mr1488 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 2.04E-07 | mr1492 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | 2.10E-06 | 2.10E-06 | mr1797 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | 2.10E-06 | 2.10E-06 | mr1801 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | 1.04E-06 | 1.04E-06 | mr1802 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 6.69E-07 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 2.85E-09 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 1.84E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 2.94E-16 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816052546 | NA | 2.01E-09 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |