\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816052546:

Variant ID: vg0816052546 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16052546
Reference Allele: AAlternative Allele: C,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCCACATCATTTTCACATTATTTAAACATATACATCTATCATTTCTATAAGTATAACTTGCATTTATCCGTACATCCCGCAGCAAATCTTGGGATAT[A/C,G]
AACTAGTTAATTAGATAGAGATATCCTACCTTATACCCTCCCATCTTTCTATCCCCATCTACCTAAAGCTGTCTTTATTCTATACATGTATGGTTATTTT

Reverse complement sequence

AAAATAACCATACATGTATAGAATAAAGACAGCTTTAGGTAGATGGGGATAGAAAGATGGGAGGGTATAAGGTAGGATATCTCTATCTAATTAACTAGTT[T/G,C]
ATATCCCAAGATTTGCTGCGGGATGTACGGATAAATGCAAGTTATACTTATAGAAATGATAGATGTATATGTTTAAATAATGTGAAAATGATGTGGAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 15.80% 0.13% 0.21% NA
All Indica  2759 99.20% 0.70% 0.04% 0.00% NA
All Japonica  1512 58.40% 41.40% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.80% 0.13% 0.00% NA
Temperate Japonica  767 28.20% 71.40% 0.39% 0.00% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 71.40% 28.60% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 82.30% 2.08% 8.33% NA
Intermediate  90 72.20% 25.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816052546 A -> G LOC_Os08g26320.1 upstream_gene_variant ; 1390.0bp to feature; MODIFIER N Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0816052546 A -> G LOC_Os08g26330.1 upstream_gene_variant ; 501.0bp to feature; MODIFIER N Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0816052546 A -> G LOC_Os08g26310.1 downstream_gene_variant ; 3032.0bp to feature; MODIFIER N Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0816052546 A -> G LOC_Os08g26320-LOC_Os08g26330 intergenic_region ; MODIFIER N Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0816052546 A -> C LOC_Os08g26320.1 upstream_gene_variant ; 1390.0bp to feature; MODIFIER silent_mutation Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0816052546 A -> C LOC_Os08g26330.1 upstream_gene_variant ; 501.0bp to feature; MODIFIER silent_mutation Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0816052546 A -> C LOC_Os08g26310.1 downstream_gene_variant ; 3032.0bp to feature; MODIFIER silent_mutation Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0816052546 A -> C LOC_Os08g26320-LOC_Os08g26330 intergenic_region ; MODIFIER silent_mutation Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N
vg0816052546 A -> DEL N N silent_mutation Average:44.719; most accessible tissue: Minghui63 young leaf, score: 71.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816052546 NA 6.94E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 3.30E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 1.92E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 4.99E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 4.47E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 8.30E-06 8.29E-06 mr1488 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 2.04E-07 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 2.10E-06 2.10E-06 mr1797 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 2.10E-06 2.10E-06 mr1801 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 1.04E-06 1.04E-06 mr1802 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 6.69E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 2.85E-09 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 1.84E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 2.94E-16 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816052546 NA 2.01E-09 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251