Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816013687:

Variant ID: vg0816013687 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 16013687
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAATGACGACACTTAGTAGGCCTGAACTCTAGGAGAAGAAGAGCGAGAGTGCTCTCCGGAGTTTAGGAACCCTTGTAACACTCAGCCATAATCCCACA[T/C]
ACAGGAGTAGGGTATTACGCTTAATAGCGGCCCGAACCTGTATAATCTTGTCGCTCGCATGCGATTTAGTAGCATTCAGGGCGGATTCGCGATCTCCCCA

Reverse complement sequence

TGGGGAGATCGCGAATCCGCCCTGAATGCTACTAAATCGCATGCGAGCGACAAGATTATACAGGTTCGGGCCGCTATTAAGCGTAATACCCTACTCCTGT[A/G]
TGTGGGATTATGGCTGAGTGTTACAAGGGTTCCTAAACTCCGGAGAGCACTCTCGCTCTTCTTCTCCTAGAGTTCAGGCCTACTAAGTGTCGTCATTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.60%	16.30%	0.06%	0.00%	NA
All Indica	2759	99.10%	0.80%	0.07%	0.00%	NA
All Japonica	1512	58.30%	41.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.50%	1.30%	0.17%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	27.80%	72.20%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	71.00%	29.00%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0816013687	T -> C	LOC_Os08g26260.1	downstream_gene_variant ; 2050.0bp to feature; MODIFIER	silent_mutation	Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0816013687	T -> C	LOC_Os08g26270.1	downstream_gene_variant ; 1544.0bp to feature; MODIFIER	silent_mutation	Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0816013687	T -> C	LOC_Os08g26280.1	downstream_gene_variant ; 3720.0bp to feature; MODIFIER	silent_mutation	Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N
vg0816013687	T -> C	LOC_Os08g26260-LOC_Os08g26270	intergenic_region ; MODIFIER	silent_mutation	Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0816013687	NA	2.43E-07	mr1069	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687	NA	4.91E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687	NA	3.07E-09	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687	NA	2.24E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687	NA	1.20E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687	NA	9.74E-07	mr1492	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687	NA	1.79E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687	NA	8.26E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687	NA	2.43E-15	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687	NA	4.96E-09	mr1952_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251