\
| Variant ID: vg0816013687 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 16013687 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )
AAAAATGACGACACTTAGTAGGCCTGAACTCTAGGAGAAGAAGAGCGAGAGTGCTCTCCGGAGTTTAGGAACCCTTGTAACACTCAGCCATAATCCCACA[T/C]
ACAGGAGTAGGGTATTACGCTTAATAGCGGCCCGAACCTGTATAATCTTGTCGCTCGCATGCGATTTAGTAGCATTCAGGGCGGATTCGCGATCTCCCCA
TGGGGAGATCGCGAATCCGCCCTGAATGCTACTAAATCGCATGCGAGCGACAAGATTATACAGGTTCGGGCCGCTATTAAGCGTAATACCCTACTCCTGT[A/G]
TGTGGGATTATGGCTGAGTGTTACAAGGGTTCCTAAACTCCGGAGAGCACTCTCGCTCTTCTTCTCCTAGAGTTCAGGCCTACTAAGTGTCGTCATTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 16.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 27.80% | 72.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 29.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0816013687 | T -> C | LOC_Os08g26260.1 | downstream_gene_variant ; 2050.0bp to feature; MODIFIER | silent_mutation | Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| vg0816013687 | T -> C | LOC_Os08g26270.1 | downstream_gene_variant ; 1544.0bp to feature; MODIFIER | silent_mutation | Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| vg0816013687 | T -> C | LOC_Os08g26280.1 | downstream_gene_variant ; 3720.0bp to feature; MODIFIER | silent_mutation | Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| vg0816013687 | T -> C | LOC_Os08g26260-LOC_Os08g26270 | intergenic_region ; MODIFIER | silent_mutation | Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0816013687 | NA | 2.43E-07 | mr1069 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816013687 | NA | 4.91E-06 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816013687 | NA | 3.07E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816013687 | NA | 2.24E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816013687 | NA | 1.20E-07 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816013687 | NA | 9.74E-07 | mr1492 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816013687 | NA | 1.79E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816013687 | NA | 8.26E-07 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816013687 | NA | 2.43E-15 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0816013687 | NA | 4.96E-09 | mr1952_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |