\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0816013687:

Variant ID: vg0816013687 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 16013687
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAATGACGACACTTAGTAGGCCTGAACTCTAGGAGAAGAAGAGCGAGAGTGCTCTCCGGAGTTTAGGAACCCTTGTAACACTCAGCCATAATCCCACA[T/C]
ACAGGAGTAGGGTATTACGCTTAATAGCGGCCCGAACCTGTATAATCTTGTCGCTCGCATGCGATTTAGTAGCATTCAGGGCGGATTCGCGATCTCCCCA

Reverse complement sequence

TGGGGAGATCGCGAATCCGCCCTGAATGCTACTAAATCGCATGCGAGCGACAAGATTATACAGGTTCGGGCCGCTATTAAGCGTAATACCCTACTCCTGT[A/G]
TGTGGGATTATGGCTGAGTGTTACAAGGGTTCCTAAACTCCGGAGAGCACTCTCGCTCTTCTTCTCCTAGAGTTCAGGCCTACTAAGTGTCGTCATTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.60% 16.30% 0.06% 0.00% NA
All Indica  2759 99.10% 0.80% 0.07% 0.00% NA
All Japonica  1512 58.30% 41.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 27.80% 72.20% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 71.00% 29.00% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0816013687 T -> C LOC_Os08g26260.1 downstream_gene_variant ; 2050.0bp to feature; MODIFIER silent_mutation Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg0816013687 T -> C LOC_Os08g26270.1 downstream_gene_variant ; 1544.0bp to feature; MODIFIER silent_mutation Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg0816013687 T -> C LOC_Os08g26280.1 downstream_gene_variant ; 3720.0bp to feature; MODIFIER silent_mutation Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N
vg0816013687 T -> C LOC_Os08g26260-LOC_Os08g26270 intergenic_region ; MODIFIER silent_mutation Average:52.844; most accessible tissue: Zhenshan97 flag leaf, score: 70.425 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0816013687 NA 2.43E-07 mr1069 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687 NA 4.91E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687 NA 3.07E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687 NA 2.24E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687 NA 1.20E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687 NA 9.74E-07 mr1492 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687 NA 1.79E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687 NA 8.26E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687 NA 2.43E-15 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0816013687 NA 4.96E-09 mr1952_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251